AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i344_weak5_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1578 300 glycosyl transferase, putative Motif number 1 CGAAATGGCAAAGTAACACCGTGGTG 1 2 1 GAATGCAAGA 0.954858 -299 CACCGTGGTGGTTATGAATATGCAATCTGCAACAC 1 27 1 GTATGATAGA 0.985661 -274 AACCTCTGTAGAAATTCATATAATAATACTACCTT 1 89 0 GAATTATAAA 0.977884 -212 CAGAGGTTATGATATTCTTAAGCTATATTTAAAGG 1 116 1 GAATTTTAGA 0.935684 -185 TTAAATCACTGTGATTAAAACGCCATTCATATTCC 1 149 0 GTATTAAAGA 0.985941 -152 TTTAATCACAGTGATTTAAAAAAACTCAAATTTCT 1 165 1 GTATTAAAAC 0.915584 -136 ATAACAAAAGGAGATGCATAGATAACCAATTAAAA 1 226 0 GAATGATAAA 0.977447 -75 TATTTTATACGTTATTTAAATAACAAAAGGAGATG 1 245 0 GTATTAAAAA 0.977884 -56 ** *** *** * * Masking position 10 Map Score: 6.61843 Number of sites scoring better than the average of aligned sites = 216 Number in coding regions = 186 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 2 GAATATGAATGGCGTTTTAATCACAGTGAT 1 150 1 GGCGTTTTAA 0.930761 -151 TTTTAATCACAGTGATTTAAAAAAACTCAA 1 164 1 AGTGATTTAA 0.957645 -137 GTTTTGAAATAGAAATTTGAGTTTTTTTAA 1 180 0 AGAAATTTGA 0.786415 -121 TCCTAAATTAATTGTTTTGAAATAGAAATT 1 193 0 ATTGTTTTGA 0.905136 -108 TTAATTTAGGAGAGTTTTAATTGGTTATCT 1 212 1 AGAGTTTTAA 0.989793 -89 AACGTATAAAATAGTTTAAAGAAGAGTGTA 1 267 1 ATAGTTTAAA 0.920054 -34 AGTTTAAAGAAGAGTGTAAAATTAGAGCTT 1 279 1 AGAGTGTAAA 0.928477 -22 ********** Masking position 10 Map Score: 3.95558 Number of sites scoring better than the average of aligned sites = 429 Number in coding regions = 338 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 3 GGCAAAGTAACACCGTGGTGGTTATGAATA 1 17 1 CACCGTGGTG 0.754304 -284 AATAATCGGTAACAGTGTTGCAGATTGCAT 1 46 0 AACAGTGTTG 0.968454 -255 ATAATAATACTACCTTGTTTATTTTCTCGA 1 75 0 TACCTTGTTT 0.911466 -226 TATGAATTTCTACAGAGGTTATGATATTCT 1 104 1 TACAGAGGTT 0.957841 -197 GCGTTTTAATCACAGTGATTTAAAAAAACT 1 161 1 CACAGTGATT 0.977947 -140 ********** Masking position 2 Map Score: 1.87185 Number of sites scoring better than the average of aligned sites = 140 Number in coding regions = 125 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 4 ACACCGTGGTGGTTATGAATATGCAATCTG 1 26 1 GGTTATGAAT 0.990652 -275 GGTAGTATTATTATATGAATTTCTACAGAG 1 91 1 TTATATGAAT 0.872842 -210 TTTCTACAGAGGTTATGATATTCTTAAGCT 1 110 1 GGTTATGATA 0.933387 -191 ATATTTAAAGGAATATGAATGGCGTTTTAA 1 140 1 GAATATGAAT 0.9531 -161 CTAAATTAATTGTTTTGAAATAGAAATTTG 1 191 0 TGTTTTGAAA 0.82572 -110 AATAACAAAAGGAGATGCATAGATAACCAA 1 232 0 GGAGATGCAT 0.93412 -69 ********** Masking position 6 Map Score: 1.57603 Number of sites scoring better than the average of aligned sites = 316 Number in coding regions = 262 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0