AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i042_Transketolase_hpyl_reg_100.orf -o042_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00489 66 AE000511 #2 RHP00492 46 AE000511 Motif number 1 TATATTATAACTAAAAGGGGGTTTT 1 6 0 CTAAAAGGGG 0.985943 -61 CCATTTTTAGCTAAAATAAAATCTATATTA 1 29 0 CTAAAATAAA 0.939787 -38 TTATTTTAGCTAAAAATGGCATGGGTTTTA 1 40 1 TAAAAATGGC 0.994631 -27 TTTGTGTTAAAATGACTCTCAAAAAC 2 7 1 TTAAAATGAC 0.991521 -40 TCAAAAACCTTAAAAATGGAAAAATTTG 2 29 1 TAAAAATGGA 0.991713 -18 ********** Masking position 5 Map Score: 6.41571 Number of sites scoring better than the average of aligned sites = 657 Number in coding regions = 581 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 2 AAAACCCCCTTTTAGTTATA 1 1 1 AAAACCCCCT 0.989234 -66 TTAGCTAAAATAAAATCTATATTATAACTA 1 23 0 TAAAATCTAT 0.966553 -44 TCCTTGCTAAAACCCATGCCATTTTTA 1 50 0 TAAAACCCAT 0.994655 -17 AATGACTCTCAAAAACCTTAAAAATGGAAA 2 21 1 AAAAACCTTA 0.959344 -26 ********** Masking position 4 Map Score: 2.22049 Number of sites scoring better than the average of aligned sites = 1265 Number in coding regions = 1086 Number in noncoding regions = 179 Number of orfs with sites within 600 bp upstream = 134 Fraction of orfs with sites within 600 bp upstream = 0.0215226 Motif number 3 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0