AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i042_Transketolase_hpyl_reg_300.orf -o042_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00489 66 AE000511 #2 RHP00492 46 AE000511 Motif number 1 AAAACCCCCTTTTAGTTATAATATA 1 6 1 CCCCTTTTAG 0.985235 -61 TAATATAGATTTTATTTTAGCTAAAAATGG 1 29 1 TTTATTTTAG 0.93695 -38 TAAAACCCATGCCATTTTTAGCTAAAATAA 1 40 0 GCCATTTTTA 0.994358 -27 GTTTTTGAGAGTCATTTTAACACAAA 2 7 0 GTCATTTTAA 0.991097 -40 CAAATTTTTCCATTTTTAAGGTTTTTGA 2 29 0 TCCATTTTTA 0.991293 -18 ********** Masking position 5 Map Score: 6.41571 Number of sites scoring better than the average of aligned sites = 657 Number in coding regions = 581 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 2 AAAATCTATATTATAACTAAAAGGGGGTTTT 1 11 0 TTTAACTAAA 0.98686 -56 CCCATGCCATTTTTAGCTAAAATAAAATCTA 1 34 0 TTTAGCTAAA 0.992645 -33 TCCTTGCTAAAACCCATGCCA 1 56 0 TCTTGCTAAA 0.994442 -11 TTTGTGTTAAAATGACTCTCA 2 1 1 TTGTGTTAAA 0.971262 -46 ** ******** Masking position 8 Map Score: 4.21563 Number of sites scoring better than the average of aligned sites = 183 Number in coding regions = 155 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 TTATAACTAAAAGGGGGTTTT 1 2 0 AAGGGGGTTT 0.985672 -65 TTAGTTATAATATAGATTTTATTTTAGCTA 1 22 1 TATAGATTTT 0.957778 -45 CTAAAAATGGCATGGGTTTTAGCAAGGA 1 49 1 CATGGGTTTT 0.995192 -18 TTTCCATTTTTAAGGTTTTTGAGAGTCATT 2 21 0 TAAGGTTTTT 0.98047 -26 ********** Masking position 8 Map Score: 1.7062 Number of sites scoring better than the average of aligned sites = 1182 Number in coding regions = 1028 Number in noncoding regions = 154 Number of orfs with sites within 600 bp upstream = 124 Fraction of orfs with sites within 600 bp upstream = 0.0199165 Motif number 4 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0