AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i072_Fatty_Acid_Bios___Butirate_Fermentation_hpyl_reg_300.orf -o072_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00119 143 AE000511 #2 RHP00120 20 AE000511 #3 RHP00121 281 AE000511 #4 RHP00124 19 AE000511 Motif number 1 AACGATATAACTAAAAATTAGAAAAACTTTAA 1 30 0 CTAAAATAGA 0.982565 -114 GACTTTTAATCTAAAAACGATATAACTAAAAA 1 45 0 CTAAAACATA 0.985341 -99 CGTTTTTAGATTAAAAGTCAGCACTATAGCGC 1 58 1 TTAAAATAGC 0.926909 -86 TTGTTATATAATAAAAGCGAGACAAGAATGTT 1 101 1 ATAAAACAGA 0.979128 -43 AATTCTATTAAAACCCTGAAACTAGGCAA 3 8 1 TTAAAACTGA 0.880882 -274 GAGTGGGGATCTAAAATCAAGCAGATATGCAC 3 91 0 CTAAAACAGC 0.992999 -191 TAGATCCCCACTCAAAGCTATATTGTGCAATA 3 110 1 CTCAAACATA 0.940138 -172 AAAACCTAAAATAAAATCCAACCTGTTAGGGT 3 206 1 ATAAAACAAC 0.856857 -76 TGTCAATCACCTAAAAGTGATACTATGAATAA 3 237 1 CTAAAATATA 0.956579 -45 ****** * *** Masking position 6 Map Score: 10.7676 Number of sites scoring better than the average of aligned sites = 857 Number in coding regions = 760 Number in noncoding regions = 97 Number of orfs with sites within 600 bp upstream = 75 Fraction of orfs with sites within 600 bp upstream = 0.0120463 Motif number 2 TAATCTAAAAACGATATAACTAAAAATTAGAAA 1 38 0 ACGATAAAAA 0.916429 -106 GCACTATAGCGCTATAAGACTAATTGTTATATA 1 78 1 GCTATAGAAA 0.941492 -66 AAGACTAATTGTTATATAATAAAAGCGAGACAA 1 93 1 GTTATAAAAA 0.971753 -51 TATAATAAAAGCGAGACAAGAATGTTAAAAAAT 1 107 1 GCGAGAAAAT 0.941366 -37 AGACAAGAATGTTAAAAAATGAAAGGAGCGTGT 1 120 1 GTTAAAAAAA 0.947699 -24 TTTTTAAAGCGTTAGAGAAACATGAGCCTAAAG 3 59 1 GTTAGAAAAT 0.88625 -223 TTTGAGTGGGGATCTAAAATCAAGCAGATATGC 3 93 0 GATCTAAAAA 0.733497 -189 AAGCTATATTGTGCAATAATCATTGAACGATAA 3 124 1 GTGCAAAAAT 0.840437 -158 TAATCATTGAACGATAAGAATAATATTTTTGTG 3 140 1 ACGATAGAAA 0.825027 -142 TAATATTTTTGTGAAAAAAATAAACGGATCGCC 3 160 1 GTGAAAAAAA 0.971802 -122 TCACCTAAAAGTGATACTATGAATAATAAATCA 3 243 1 GTGATATAAA 0.911725 -39 ****** ** ** Masking position 6 Map Score: 6.46798 Number of sites scoring better than the average of aligned sites = 764 Number in coding regions = 663 Number in noncoding regions = 101 Number of orfs with sites within 600 bp upstream = 81 Fraction of orfs with sites within 600 bp upstream = 0.01301 Motif number 3 GTTTGAATGCTCCGCATTAAAGTTTTTCTAAT 1 14 1 TCGCATAAAG 0.980621 -130 AGATTAAAAGTCAGCACTATAGCGCTATAAGA 1 65 1 TAGCATATAG 0.980998 -79 TATATAACAATTAGTCTTATAGCGCTATAGTG 1 79 0 TAGTCTATAG 0.889948 -65 AGAGCAAACGCCATTTAGAT 2 3 0 ACGCCTTTAG 0.957258 -18 ATCAAGCAGATATGCACTTTAGGCTCATGTTT 3 76 0 TTGCATTTAG 0.975399 -206 CAATGATTATTGCACAATATAGCTTTGAGTGG 3 117 0 TCACATATAG 0.937842 -165 GTCTTTGCCTTTAAGTTGATTTATT 3 267 0 TTGCCTTAAG 0.954189 -15 * **** ***** Masking position 11 Map Score: 4.18251 Number of sites scoring better than the average of aligned sites = 243 Number in coding regions = 222 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 4 TTTCTAAGCAGTCTTTGCCTAGTTTCAGGG 3 24 0 GTCTTTGCCT 0.997673 -258 GTCTTTGCCTTTAAGTTGAT 3 272 0 GTCTTTGCCT 0.997673 -10 ********** Masking position 5 Map Score: 1.55727 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 9 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0