AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i142_Cytochrome_Oxidase_hpyl_reg_300.orf -o142_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01099 300 AE000511 Motif number 1 TTTTCATGGGCATGATTATAG 1 2 0 CATGATTATA 0.957798 -299 TAATCATGCCCATGAAAATACAAAAATAAA 1 14 1 CATGAAAATA 0.709211 -287 CATGAAAATACAAAAATAAAGCCAAGCGTT 1 24 1 CAAAAATAAA 0.963617 -277 CGGTGCGCCTAAAAAATACAACAGCGTTGC 1 69 1 AAAAAATACA 0.846396 -232 AAAGGTTAAACATGATTAAACAAACCCTCA 1 122 0 CATGATTAAA 0.977514 -179 ATCTTTGGCTAAAGGTTAAACATGATTAAA 1 132 0 AAAGGTTAAA 0.944354 -169 TGAGTTATTACAATGTTACAGAAAAAGATT 1 200 1 CAATGTTACA 0.772354 -101 TGTTACAGAAAAAGATTAAAAATTAAGCTT 1 213 1 AAAGATTAAA 0.964408 -88 GCTTTTTGAAAAAGAATAAAATTTTATAAT 1 239 1 AAAGAATAAA 0.957986 -62 CAAAGATAAACATAATTATAAAATTTTATT 1 253 0 CATAATTATA 0.90054 -48 GTAAATTCAACAAAGATAAACATAATTATA 1 263 0 CAAAGATAAA 0.943144 -38 ********** Masking position 8 Map Score: 14.5023 Number of sites scoring better than the average of aligned sites = 901 Number in coding regions = 769 Number in noncoding regions = 132 Number of orfs with sites within 600 bp upstream = 101 Fraction of orfs with sites within 600 bp upstream = 0.0162223 Motif number 2 CCGGTGCGCCTAAAAAATACAACAGCGTTG 1 68 1 TAAAAAATAC 0.776347 -233 AGCGTTGCGATAAAAAAAGGGGCAAGAATG 1 91 1 TAAAAAAAGG 0.968929 -210 GCAATTTGGCTTAAAAATGCCATTCAAATG 1 166 1 TTAAAAATGC 0.943081 -135 AAAAATGCCATTCAAATGGGATTGAGTTAT 1 178 1 TTCAAATGGG 0.942643 -123 TTTATTCTTTTTCAAAAAGCTTAATTTTTA 1 229 0 TTCAAAAAGC 0.98458 -72 TTGTAGTAAATTCAACAAAGATAAACATAA 1 268 0 TTCAACAAAG 0.875613 -33 TTGAATTTACTACAAATAGGAGTATTGC 1 283 1 TACAAATAGG 0.965539 -18 ********** Masking position 5 Map Score: 4.48876 Number of sites scoring better than the average of aligned sites = 1612 Number in coding regions = 1366 Number in noncoding regions = 246 Number of orfs with sites within 600 bp upstream = 166 Fraction of orfs with sites within 600 bp upstream = 0.0266624 Motif number 3 TTGTATTTTCATGGGCATGATTATAG 1 7 0 ATGGGCATGA 0.98446 -294 TACAACAGCGTTGCGATAAAAAAAGGGGCA 1 85 1 TTGCGATAAA 0.853314 -216 CGATAAAAAAAGGGGCAAGAATGATGAGGG 1 98 1 AGGGGCAAGA 0.958621 -203 TGCTACTATCTTTGGCTAAAGGTTAAACAT 1 139 0 TTTGGCTAAA 0.905494 -162 ATAGTAGCAATTTGGCTTAAAAATGCCATT 1 160 1 TTTGGCTTAA 0.953646 -141 TGCCATTCAAATGGGATTGAGTTATTACAA 1 183 1 ATGGGATTGA 0.975578 -118 ********** Masking position 10 Map Score: 2.48931 Number of sites scoring better than the average of aligned sites = 982 Number in coding regions = 932 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0