AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i146_NADH-formate_Dehydrogenase_hpyl_reg_300.orf -o146_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00650 116 AE000511 #2 RHP00654 69 AE000511 #3 RHP00655 101 AE000511 Motif number 1 AATTTAGTTTTAATTTCAAGCGTGGTGCGTTA 1 22 0 TAATCAAGCG 0.993591 -95 AAATTAAAACTAAATTTTAGTGTATTCTTAGC 1 38 1 TAATTTAGTG 0.975158 -79 AAATTTTAGATAAGATCAAGCGTGATTTTTTC 1 70 1 TAATCAAGCG 0.993591 -47 CTTAAATGCCTAAAATTTAGAAAAAATCACGC 1 89 0 TAATTTAGAA 0.964358 -28 AAAATTTAGTAATCTTAAGCGGGGCTGGTAT 2 10 1 TAATTAAGCG 0.993717 -60 AGCGGGATTAAAACCTTTAGAGACGCTG 2 52 1 AAATTTAGAG 0.925399 -18 TTTTTTCAGCTAACGATTAGCAAAAACATGGT 3 32 1 TAAATTAGCA 0.973197 -70 CAAACTCCTTTAATTACTAGCAAATGACAAAG 3 72 0 TAAACTAGCA 0.972656 -30 *** ******* Masking position 9 Map Score: 13.4159 Number of sites scoring better than the average of aligned sites = 285 Number in coding regions = 258 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 AGAATACACTAAAATTTAGTTTTAATTTCA 1 36 0 AAAATTTAGT 0.99132 -81 TATTCTTAGCAAATTTTAGATAAGATCAAG 1 60 1 AAATTTTAGA 0.982401 -57 GATTTTTTCTAAATTTTAGGCATTTAAGGA 1 93 1 AAATTTTAGG 0.979131 -24 AAAATTTAGTAATCTTAAGC 2 1 1 AAAATTTAGT 0.99132 -69 GCGGGATTAAAACCTTTAGAGACGCTG 2 53 1 AACCTTTAGA 0.944919 -17 CTGAAAAAATAAAAATTATTTTAACATTTC 3 11 0 AAAAATTATT 0.803992 -91 ********** Masking position 6 Map Score: 7.2354 Number of sites scoring better than the average of aligned sites = 436 Number in coding regions = 358 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 3 TCAAGCGTGGTGCGTTAAAGGCGGTGGT 1 8 0 TGGTTAAAGG 0.937405 -109 CACCACGCTTGAAATTAAAACTAAATTTTAG 1 27 1 GAATTAAAAC 0.944862 -90 CTAAATTTTAGGCATTTAAGGAATCA 1 101 1 GGATTTAAGG 0.993002 -16 AAGCGGGGCTGGTATTTCAGCAGAAAGCGGG 2 27 1 GGATTTCAGC 0.981063 -43 AGCAGAAAGCGGGATTAAAACCTTTAGAGAC 2 45 1 GGATTAAAAC 0.988926 -25 TCATTTGCTAGTAATTAAAGGAGTTTGAGAG 3 77 1 GTATTAAAGG 0.980668 -25 ** ******** Masking position 6 Map Score: 4.20646 Number of sites scoring better than the average of aligned sites = 548 Number in coding regions = 491 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 4 AAATCACGCTTGATCTTATCTAAAATTTGC 1 68 0 TGATCTTATC 0.977025 -49 AGATCAAGCGTGATTTTTTCTAAATTTTAG 1 82 1 TGATTTTTTC 0.985806 -35 AAAAATTATTTTAACATTTC 3 1 0 TTAACATTTC 0.91578 -101 AAAATAATTTTTATTTTTTCAGCTAACGAT 3 19 1 TTATTTTTTC 0.978215 -83 ********** Masking position 7 Map Score: 1.86106 Number of sites scoring better than the average of aligned sites = 181 Number in coding regions = 163 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0