AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i211_transcription_translation_hpyl_reg_100.orf -o211_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RHP01464 263 AE000511 Input sequences: #1 RHP01465 263 AE000511 Motif number 1 GAAATCTCTTTTTGTTAAAAGGAAATTTA 1 7 0 TTTTTAAAAA 0.976311 -257 TTGTTGCAATTAAGATAAAAATACAAAAAGCTA 1 44 1 TAAATAAAAA 0.958874 -220 AAGCTAAAGCATTCTTAAAAAATTAGTGTAACC 1 71 1 ATTTTAAAAT 0.893612 -193 AAAATTTGACTTTGTTAAAAAAATTATGATAGC 1 162 0 TTTTTAAAAA 0.925747 -102 CACTCTAAAGTTAAATAAAATTTGACTTTGTTA 1 178 0 TTAATAAAAT 0.89815 -86 TAAGTCATAATAAATTAAAACCACTCTAAAGTT 1 199 0 TAATTAAAAA 0.984957 -65 TTTTAAATTTAAACTTAAAATTATAGCATAAGT 1 227 0 AAATTAAAAA 0.945411 -37 TTTTAAGTTTAAATTTAAAAATAAAGGATACTT 1 240 1 AAATTAAAAA 0.717703 -24 *** ****** * Masking position 7 Map Score: 10.4491 Number of sites scoring better than the average of aligned sites = 413 Number in coding regions = 273 Number in noncoding regions = 140 Number of orfs with sites within 600 bp upstream = 122 Fraction of orfs with sites within 600 bp upstream = 0.0195952 Motif number 2 TTTTTATCTTAATTGCAACAAACTAGAAATCTCTTTT 1 28 0 AATGCAACAA 0.995297 -236 ATTAAGATAAAAATACAAAAAGCTAAAGCATTCTTAA 1 52 1 AATACAACAA 0.994931 -212 ATTCTTAAAAAATTAGTGTAACCAAAAGATGCTAATA 1 81 1 AATAGAACAA 0.992572 -183 AGATGCTAATAAGTGGCCCATGCCACAAGTGTTGAAT 1 107 1 AATGGATCAA 0.990245 -157 CATAGCAAAGAATTACGAAATTCAACACTTGTGGCAT 1 126 0 AATACATCAA 0.992752 -138 ** *** ** * * * Masking position 10 Map Score: 3.80619 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 28 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 CTTTTTGTTAAAAGGAAATTTA 1 2 0 AAAGGAATTT 0.978294 -262 CCTTTTAACAAAAAGAGATTTCTAGTTTGTT 1 18 1 AAAAGAATTT 0.910801 -246 ACAAAAAGCTAAAGCATTCTTAAAAAATTAG 1 66 1 AAAGCATCTT 0.980176 -198 TAGTGTAACCAAAAGATGCTAATAAGTGGCC 1 94 1 AAAAGAGCTA 0.950229 -170 TAATAAATTAAAACCACTCTAAAGTTAAATA 1 194 0 AAACCATCTA 0.907729 -70 ATTTAAAAATAAAGGATACTTG 1 252 1 AAAGGAACTT 0.992726 -12 ****** **** Masking position 6 Map Score: 3.65516 Number of sites scoring better than the average of aligned sites = 254 Number in coding regions = 205 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 4 AAAAATACAAAAAGCTAAAGCATTCTTAAA 1 60 1 AAAGCTAAAG 0.970844 -204 TTTTTTTAACAAAGTCAAATTTTATTTAAC 1 172 1 AAAGTCAAAT 0.982689 -92 AAACCACTCTAAAGTTAAATAAAATTTGAC 1 185 0 AAAGTTAAAT 0.989772 -79 CTATAATTTTAAGTTTAAATTTAAAAATAA 1 234 1 AAGTTTAAAT 0.934582 -30 ********** Masking position 7 Map Score: 1.83658 Number of sites scoring better than the average of aligned sites = 53 Number in coding regions = 42 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 CTTTTGGTTACACTAATTTTTTAAGAATGC 1 79 0 CACTAATTTT 0.887311 -185 TGGCCCATGCCACAAGTGTTGAATTTCGTA 1 120 1 CACAAGTGTT 0.957653 -144 TGTTGAATTTCGTAATTCTTTGCTATGCTA 1 136 1 CGTAATTCTT 0.956068 -128 GCTATGCTATCATAATTTTTTTAACAAAGT 1 157 1 CATAATTTTT 0.977711 -107 AAAATTATAGCATAAGTCATAATAAATTAA 1 214 0 CATAAGTCAT 0.927913 -50 CAAGTATCCTTTATTTTTAAATTTAAAC 1 246 0 CTTTATTTTT 0.879433 -18 ********** Masking position 5 Map Score: 1.14887 Number of sites scoring better than the average of aligned sites = 329 Number in coding regions = 284 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 6 CATGGGCCACTTATTAGCATCTTTTGGTTA 1 99 0 TTATTAGCAT 0.954554 -165 TAAAAAAATTATGATAGCATAGCAAAGAAT 1 150 0 ATGATAGCAT 0.677865 -114 TAAACTTAAAATTATAGCATAAGTCATAAT 1 221 0 ATTATAGCAT 0.940457 -43 ********** Masking position 6 Map Score: 0.572359 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 11 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 7 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0