AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i211_transcription_translation_hpyl_reg_300.orf -o211_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RHP01464 263 AE000511 Input sequences: #1 RHP01465 263 AE000511 Motif number 1 GAAATCTCTTTTTGTTAAAAGGAAATTTA 1 7 0 TTTTTAAAAA 0.977819 -257 TTGTTGCAATTAAGATAAAAATACAAAAAGCTA 1 44 1 TAAATAAAAA 0.961254 -220 AAGCTAAAGCATTCTTAAAAAATTAGTGTAACC 1 71 1 ATTTTAAAAT 0.898521 -193 AAAATTTGACTTTGTTAAAAAAATTATGATAGC 1 162 0 TTTTTAAAAA 0.923925 -102 CACTCTAAAGTTAAATAAAATTTGACTTTGTTA 1 178 0 TTAATAAAAT 0.904097 -86 TAAGTCATAATAAATTAAAACCACTCTAAAGTT 1 199 0 TAATTAAAAA 0.985903 -65 TTTTAAATTTAAACTTAAAATTATAGCATAAGT 1 227 0 AAATTAAAAA 0.944789 -37 TTTTAAGTTTAAATTTAAAAATAAAGGATACTT 1 240 1 AAATTAAAAA 0.710353 -24 *** ****** * Masking position 7 Map Score: 10.4491 Number of sites scoring better than the average of aligned sites = 413 Number in coding regions = 273 Number in noncoding regions = 140 Number of orfs with sites within 600 bp upstream = 122 Fraction of orfs with sites within 600 bp upstream = 0.0195952 Motif number 2 TTTCCTTTTAACAAAAAGAGATTTCTAGTTTG 1 15 1 ACAAAGAGAT 0.886004 -249 TCTTAATTGCAACAAACTAGAAATCTCTTTTT 1 27 0 AAAAATAGAA 0.950018 -237 AGATAAAAATACAAAAAGCTAAAGCATTCTTA 1 56 1 ACAAAGCTAA 0.969083 -208 AATTAGTGTAACCAAAAGATGCTAATAAGTGG 1 91 1 ACAAAGATGC 0.947935 -173 GCAAAGAATTACGAAATTCAACACTTGTGGCA 1 127 0 ACAAATCAAC 0.948259 -137 GACTTTGTTAAAAAAATTATGATAGCATAGCA 1 156 0 AAAAATATGA 0.918062 -108 TAATTTTTTTAACAAAGTCAAATTTTATTTAA 1 169 1 AAAAATCAAA 0.93558 -95 CATAAGTCATAATAAATTAAAACCACTCTAAA 1 202 0 AAAAATAAAA 0.946257 -62 TAAATTTAAAAATAAAGGATACTTG 1 249 1 AAAAAGATAC 0.966591 -15 ** *** ***** Masking position 6 Map Score: 7.94686 Number of sites scoring better than the average of aligned sites = 699 Number in coding regions = 577 Number in noncoding regions = 122 Number of orfs with sites within 600 bp upstream = 108 Fraction of orfs with sites within 600 bp upstream = 0.0173466 Motif number 3 TAAATTTCCTTTTAACAAAAAGAGATTTC 1 10 1 TTTTAACAAA 0.949769 -254 ATTTTTATCTTAATTGCAACAAACTAGAAA 1 36 0 TAATTGCAAC 0.890621 -228 ATGGGCCACTTATTAGCATCTTTTGGTTAC 1 98 0 TATTAGCATC 0.970586 -166 AAAAAAATTATGATAGCATAGCAAAGAATT 1 149 0 TGATAGCATA 0.970983 -115 ATCATAATTTTTTTAACAAAGTCAAATTTT 1 165 1 TTTTAACAAA 0.949769 -99 AAACTTAAAATTATAGCATAAGTCATAATA 1 220 0 TTATAGCATA 0.982765 -44 ********** Masking position 4 Map Score: 4.73416 Number of sites scoring better than the average of aligned sites = 184 Number in coding regions = 127 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 4 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0