AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i218_Ribosomal_Operon_5_hpyl_reg_300.orf -o218_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01413 99 AE000511 #2 RHP01414 124 AE000511 Motif number 1 TTCTTAAACAAACCATTTAAAAATTAGCC 1 6 1 AAAACCATTA 0.941396 -94 AACCATTTAAAAATTAGCCTTAAAATCAGTCTTT 1 21 1 AAATCCTTAA 0.994673 -79 CATTATACTTAAAATAGCCTTTAAAAAGACTGAT 1 45 0 AAATCCTTAA 0.994635 -55 TTATTGAAATAAACTTTGCATTATACTTAAAATA 1 63 0 AAATGCATAT 0.947235 -37 AAAATCCCCTAAAATCGCCATGCT 2 1 1 AAATCCTAAA 0.99222 -124 GCCATGCTTGAAATTTAGAAAAAAGAAAATTGTA 2 27 1 AAATGAAAAA 0.883947 -98 TAAGTAAATCAATTTGCGCTACAATTTTCTTTTT 2 46 0 AATTGCTAAA 0.947213 -79 TGATTTACTTAAAAATAGCATGAATAGGGTAGGA 2 69 1 AAAAGCATAA 0.982991 -56 CCTAAAAATTAAAATAAGCTTCTATCCTACCCTA 2 93 0 AAATGCTTTA 0.981111 -32 AAAAGATTCCTAAAAATTAAAATAA 2 110 0 AAAACCTAAA 0.982992 -15 *** * **** ** Masking position 2 Map Score: 17.6935 Number of sites scoring better than the average of aligned sites = 1132 Number in coding regions = 928 Number in noncoding regions = 204 Number of orfs with sites within 600 bp upstream = 143 Fraction of orfs with sites within 600 bp upstream = 0.0229682 Motif number 2 AAAGACTGATTTTAAGGCTAATTTTTAAAT 1 25 0 TTTAAGGCTA 0.994654 -75 ATCAGTCTTTTTAAAGGCTATTTTAAGTAT 1 45 1 TTAAAGGCTA 0.980576 -55 CTATTTTAAGTATAATGCAAAGTTTATTTC 1 62 1 TATAATGCAA 0.841699 -38 TATTTCAATAATTAAGGATACACA 1 86 1 ATTAAGGATA 0.973402 -14 TCATGCTATTTTTAAGTAAATCAATTTGCG 2 62 0 TTTAAGTAAA 0.784544 -63 ATCCTACCCTATTCATGCTATTTTTAAGTA 2 74 0 ATTCATGCTA 0.928487 -51 ********** Masking position 5 Map Score: 5.09022 Number of sites scoring better than the average of aligned sites = 923 Number in coding regions = 799 Number in noncoding regions = 124 Number of orfs with sites within 600 bp upstream = 117 Fraction of orfs with sites within 600 bp upstream = 0.0187922 Motif number 3 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0