AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i219_Ribosomal_Operon_6_hpyl_reg_300.orf -o219_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01627 100 AE000511 #2 RHP01474 247 AE000511 Motif number 1 AAATTCTTGACAACCAGTTAATTCGTCTTATATAATACTAT 1 8 1 TGCAAATTAT 0.985178 -93 TGCTTAACAATGGCTACAAATGAAATAGTATTATATAAGACGAA 1 32 0 TGCAAATTAT 0.985764 -69 AAGCAATGATTTTAAGCTATGGAAAAGAGGTGATAGCAGT 1 71 1 TTCAAATGAT 0.970143 -30 TTTTTATTTCCTAATTCCATTAAAATTTCCTTTTTTAGTTAGTG 2 66 1 CTCAAATTTT 0.985758 -182 GACGGCTATTCTAACATGAAATAAACGCCGTTTTATATTAAATC 2 124 1 CTTAAATTTT 0.885531 -124 CCGTTTTATATTAAATCTAAAGAAAAATATTTTTAGATGTGCTA 2 151 1 TTCAAATTTT 0.991892 -97 GAATACCCATTTGTTACAAGATAAGCTTTTTTATCAAAAATAAT 2 195 1 TTCAAATTAT 0.991892 -53 TTGTTACCCCTATGTCATCATTATTTTTGATAAAAAA 2 221 0 TTCACATTTT 0.970143 -27 ** * * ** **** Masking position 14 Map Score: 6.49382 Number of sites scoring better than the average of aligned sites = 219 Number in coding regions = 191 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 2 AAATAGTATTATATAAGACGAATTAACTGG 1 24 0 ATATAAGACG 0.942714 -77 GGAAATAAAAATATAAAACCCGGTCGCAAG 2 47 0 ATATAAAACC 0.979584 -201 TACACACTAACTAAAAAAGGAAATTTTAAT 2 84 0 CTAAAAAAGG 0.94149 -164 TTATTTCATGTTAGAATAGCCGTCATGATA 2 118 0 TTAGAATAGC 0.865302 -130 TTTAGATTTAATATAAAACGGCGTTTATTT 2 142 0 ATATAAAACG 0.973355 -106 TTTAGATGTGCTAGAATACCCATTTGTTAC 2 182 1 CTAGAATACC 0.958359 -66 ATTATTTTTGATAAAAAAGCTTATCTTGTA 2 209 0 ATAAAAAAGC 0.962255 -39 ********** Masking position 5 Map Score: 5.3362 Number of sites scoring better than the average of aligned sites = 397 Number in coding regions = 344 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 3 TACTATTTCATTTGTAGCCATTGTTAAGCAA 1 46 1 TTTGTAGCAT 0.986358 -55 TTGTAGCCATTGTTAAGCAATGATTTTAAGC 1 57 1 TGTTAAGCAT 0.974845 -44 TAAGCAATGATTTTAAGCTATGGAAAAGAGG 1 70 1 TTTTAAGCAT 0.979056 -31 AAAATTTCCTTTTTTAGTTAGTGTGTAGTAA 2 87 1 TTTTTAGTAG 0.934012 -161 TTTTAGTTAGTGTGTAGTAATATCATGACGG 2 98 1 TGTGTAGTAT 0.963776 -150 AAGAAAAATATTTTTAGATGTGCTAGAATAC 2 170 1 TTTTTAGAGT 0.88922 -78 ******** ** Masking position 6 Map Score: 2.82502 Number of sites scoring better than the average of aligned sites = 303 Number in coding regions = 266 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 4 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0