AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i228_6_1_1_17_hpyl_reg_300.orf -o228_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01398 117 AE000511 Motif number 1 ATGATTGAGATTATTTTTGATTAGGATCAA 1 13 0 TTATTTTTGA 0.984593 -105 CAATCATACACTAATTTTAATAGAAAAAAG 1 36 1 CTAATTTTAA 0.980258 -82 AAAAGTGAAACCATTTTTAAGCCATTTTTG 1 61 1 CCATTTTTAA 0.995778 -57 CATTTTTAAGCCATTTTTGAATACAATAAG 1 72 1 CCATTTTTGA 0.996025 -46 TAAGAGTATTTTATTTTTAAGGTTAGAACA 1 98 1 TTATTTTTAA 0.984421 -20 ********** Masking position 5 Map Score: 12.574 Number of sites scoring better than the average of aligned sites = 100 Number in coding regions = 74 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 2 GGTTGATCCTAATCAAAAATAATCTC 1 7 1 TCCTAATCAA 0.988742 -111 TTTCACTTTTTTCTATTAAAATTAGTGTAT 1 41 0 TTCTATTAAA 0.97384 -77 AATACTCTTATTGTATTCAAAAATGGCTTA 1 78 0 TTGTATTCAA 0.668648 -40 ********** Masking position 5 Map Score: 1.84036 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 41 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0