AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i252_chemotaxis1_hpyl_reg_100.orf -o252_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00236 132 AE000511 Motif number 1 AGTTTGATGAAAGGAAAATC 1 1 0 AAGGAAAATC 0.923485 -132 ATTTTCCTTTCATCAAACTCATCTCAACCA 1 12 1 CATCAAACTC 0.992239 -121 GCGCTATTCTAGTCAAAATCGCCTTATTTT 1 54 1 AGTCAAAATC 0.987545 -79 AAAATCATAGCGCAAAAATAAGGCGATTTT 1 68 0 CGCAAAAATA 0.876497 -65 AGTCATTATTATTGAAAATCATAGCGCAAA 1 82 0 ATTGAAAATC 0.974613 -51 TCCAAACTCCCTTCAAACTAGTTTTAAAAA 1 111 0 CTTCAAACTA 0.980382 -22 ACTCCAAACTCCCTTCAAACT 1 122 0 CTCCAAACTC 0.993459 -11 ********** Masking position 5 Map Score: 9.44772 Number of sites scoring better than the average of aligned sites = 798 Number in coding regions = 745 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 TCTCAACCAACAATAATAGAAGCGCTATTCT 1 33 1 CAATAATAGA 0.986757 -100 GCGATTTTGACTAGAATAGCGCTTCTATTAT 1 45 0 CTAGAATAGG 0.986686 -88 AATCATAGCGCAAAAATAAGGCGATTTTGAC 1 65 0 CAAAAATAAG 0.986494 -68 TTATTATTGAAAATCATAGCGCAAAAATAAG 1 76 0 AAATCATAGG 0.973592 -57 CTATGATTTTCAATAATAATGACTTTTTAAA 1 88 1 CAATAATAAG 0.921246 -45 ********* * Masking position 6 Map Score: 5.71701 Number of sites scoring better than the average of aligned sites = 268 Number in coding regions = 234 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 3 CCTTTCATCAAACTCATCTCAACCAACAAT 1 17 1 AACTCATCTC 0.973508 -116 TTTGACTAGAATAGCGCTTCTATTATTGTT 1 41 0 ATAGCGCTTC 0.875238 -92 ATTCTAGTCAAAATCGCCTTATTTTTGCGC 1 59 1 AAATCGCCTT 0.836507 -74 ACTCCCTTCAAACTAGTTTTAAAAAGTCAT 1 106 0 AACTAGTTTT 0.918723 -27 ACTCCAAACTCCCTTCAAACTAGTTT 1 117 0 AACTCCCTTC 0.990887 -16 ********** Masking position 9 Map Score: 1.42554 Number of sites scoring better than the average of aligned sites = 1084 Number in coding regions = 997 Number in noncoding regions = 87 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 4 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0