AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i256_heat_shock1_hpyl_reg_100.orf -o256_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01432 290 AE000511 #2 RHP01433 60 AE000511 Motif number 1 ATCAAACTCAATTCATAACAATTAAAGGTGGTT 1 12 0 ATCAACAATT 0.981462 -279 TGCTATAATCACCCCTATCAATCAAACTCAATT 1 32 0 ACCCACAATC 0.995214 -259 CATGCGGTAAAATCCGCTAAATCAAGGAGTGTT 1 112 1 ATCCCAAATC 0.92674 -179 TTTTGAAGAAAATCAAAACAATCAATTTGTCAT 1 180 1 ATCAACAATC 0.988231 -111 TCAATTTGTCATTCCTATCTATCAGAGGTTGTA 1 201 1 ATCCACTATC 0.992616 -90 AAAAAGGAATAATGCGAACAATTATGGGATGAT 1 241 1 ATGCACAATT 0.974552 -50 CTTATCATTCCCACCAATTTTTATAATAT 1 272 0 ATCCACAATT 0.995698 -19 AAACCCAACTTATTCAAAATAAAG 2 2 1 ACCCATTATT 0.861582 -59 * *** * ***** Masking position 11 Map Score: 10.9698 Number of sites scoring better than the average of aligned sites = 255 Number in coding regions = 234 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 ATAAATGCTATAATCACCCCTATCAATCAA 1 40 0 TAATCACCCC 0.978214 -251 TGCTTCCATAATAACACTCCTTGATTTAGC 1 127 0 ATAACACTCC 0.966698 -164 AACAATCAATTTGTCATTCCTATCTATCAG 1 196 1 TTGTCATTCC 0.982791 -95 AATTTTTATAATATCATCCCATAATTGTTC 1 256 0 ATATCATCCC 0.989638 -35 CTTATCATTCCCACCAATTTT 1 280 0 TTATCATTCC 0.992173 -11 ********** Masking position 6 Map Score: 5.81217 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 27 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 GATAGGGGTGATTATAGCATTTATGGGGCAAA 1 46 1 ATTTAGCTTT 0.977977 -245 CTTGATACAGATTCTACTTTTTTTGCCCCATA 1 67 0 ATTTACTTTT 0.985795 -224 GATTTAGCGGATTTTACCGCATGCATCTTAAT 1 103 0 ATTTACCCAT 0.955374 -188 AATTGTTCGCATTATTCCTTTTTCCAACTATA 1 232 0 ATTTTCCTTT 0.979392 -59 GTAATTTGTAATTATACTCTTTATTTTGAATA 2 21 0 ATTTACTTTT 0.985795 -40 *** **** *** Masking position 5 Map Score: 2.6479 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 39 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 4 ACTCAATTCATAACAATTAAAGGTGGTTA 1 10 0 TAACAATTAA 0.838353 -281 CCCCTATCAATCAAACTCAATTCATAACAA 1 24 0 TCAAACTCAA 0.87874 -267 TGCATCTTAATAAAACTTGATACAGATTCT 1 84 0 TAAAACTTGA 0.957205 -207 AGATAGGAATGACAAATTGATTGTTTTGAT 1 191 0 GACAAATTGA 0.86737 -100 TATTCCTTTTTCCAACTATACAACCTCTGA 1 222 0 TCCAACTATA 0.732616 -69 GATGATATTATAAAAATTGGTGGGAATGAT 1 268 1 TAAAAATTGG 0.852219 -23 CCCAACTTATTCAAAATAAAGAGTATAATT 2 14 1 TCAAAATAAA 0.870084 -47 AGAGTATAATTACAAATTACTTACAACTTA 2 33 1 TACAAATTAC 0.883598 -28 ACAAATTACTTACAACTTAAAGGGGAT 2 44 1 TACAACTTAA 0.973518 -17 ********** Masking position 5 Map Score: 2.41001 Number of sites scoring better than the average of aligned sites = 426 Number in coding regions = 312 Number in noncoding regions = 114 Number of orfs with sites within 600 bp upstream = 110 Fraction of orfs with sites within 600 bp upstream = 0.0176678 Motif number 5 ********** No masking Map Score: 3.7902e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.7902e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.7902e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0