AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i256_heat_shock1_hpyl_reg_300.orf -o256_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01432 290 AE000511 #2 RHP01433 60 AE000511 Motif number 1 AACCACCTTTAATTGTTATGAATTGAGTTTGAT 1 12 1 AATTGTTGAT 0.981574 -279 AATTGAGTTTGATTGATAGGGGTGATTATAGCA 1 32 1 GATTGTGGGT 0.995243 -259 AACACTCCTTGATTTAGCGGATTTTACCGCATG 1 112 0 GATTTGGGAT 0.927157 -179 ATGACAAATTGATTGTTTTGATTTTCTTCAAAA 1 180 0 GATTGTTGAT 0.988303 -111 TACAACCTCTGATAGATAGGAATGACAAATTGA 1 201 0 GATAGTGGAT 0.992661 -90 ATCATCCCATAATTGTTCGCATTATTCCTTTTT 1 241 0 AATTGTGCAT 0.974704 -50 ATATTATAAAAATTGGTGGGAATGATAAG 1 272 1 AATTGTGGAT 0.995725 -19 CTTTATTTTGAATAAGTTGGGTTT 2 2 0 AATAATGGGT 0.862316 -59 ***** * *** * Masking position 2 Map Score: 10.9698 Number of sites scoring better than the average of aligned sites = 255 Number in coding regions = 234 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 TTGATTGATAGGGGTGATTATAGCATTTAT 1 40 1 GGGGTGATTA 0.978214 -251 GCTAAATCAAGGAGTGTTATTATGGAAGCA 1 127 1 GGAGTGTTAT 0.966698 -164 CTGATAGATAGGAATGACAAATTGATTGTT 1 196 0 GGAATGACAA 0.982791 -95 GAACAATTATGGGATGATATTATAAAAATT 1 256 1 GGGATGATAT 0.989638 -35 AAAATTGGTGGGAATGATAAG 1 280 1 GGAATGATAA 0.992173 -11 ********** Masking position 5 Map Score: 5.81217 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 27 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 TTTGCCCCATAAATGCTATAATCACCCCTATC 1 46 0 AAAGCTAAAT 0.97811 -245 TATGGGGCAAAAAAAGTAGAATCTGTATCAAG 1 67 1 AAAAGTAAAT 0.985881 -224 ATTAAGATGCATGCGGTAAAATCCGCTAAATC 1 103 1 ATGGGTAAAT 0.955635 -188 TATAGTTGGAAAAAGGAATAATGCGAACAATT 1 232 1 AAAGGAAAAT 0.979516 -59 TATTCAAAATAAAGAGTATAATTACAAATTAC 2 21 1 AAAAGTAAAT 0.985881 -40 *** **** *** Masking position 8 Map Score: 2.6479 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 39 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 4 TCAAACTCAATTCATAACAATTAAAGGTGG 1 14 0 TTCATAACAA 0.977485 -277 TACCGCATGCATCTTAATAAAACTTGATAC 1 91 0 ATCTTAATAA 0.943438 -200 TGCGTCTGCTTCCATAATAACACTCCTTGA 1 133 0 TCCATAATAA 0.954226 -158 TCTTCAAAAAATCCTAATAGTGTGGTTGCG 1 159 0 ATCCTAATAG 0.903928 -132 TTTGAAGAAAATCAAAACAATCAATTTGTC 1 181 1 ATCAAAACAA 0.962093 -110 ACCCAACTTATTCAAAATAAAGAGTATAAT 2 13 1 TTCAAAATAA 0.968283 -48 ********** Masking position 6 Map Score: 4.2728 Number of sites scoring better than the average of aligned sites = 214 Number in coding regions = 181 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 5 AACTCAATTCATAACAATTAAAGGTGGTTA 1 11 0 ATAACAATTA 0.79064 -280 ATAAAACTTGATACAGATTCTACTTTTTTT 1 75 0 ATACAGATTC 0.912506 -216 ATGCATCTTAATAAAACTTGATACAGATTC 1 85 0 ATAAAACTTG 0.956359 -206 TAGATAGGAATGACAAATTGATTGTTTTGA 1 192 0 TGACAAATTG 0.904486 -99 TTTTCCAACTATACAACCTCTGATAGATAG 1 215 0 ATACAACCTC 0.910894 -76 GGATGATATTATAAAAATTGGTGGGAATGA 1 267 1 ATAAAAATTG 0.957187 -24 AAGAGTATAATTACAAATTACTTACAACTT 2 32 1 TTACAAATTA 0.957759 -29 TACAAATTACTTACAACTTAAAGGGGAT 2 43 1 TTACAACTTA 0.956942 -18 ********** Masking position 3 Map Score: 5.00604 Number of sites scoring better than the average of aligned sites = 149 Number in coding regions = 118 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 6 ********** No masking Map Score: 3.7902e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.7902e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.7902e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0