AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i262_3_5_1_28_hpyl_reg_100.orf -o262_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RHP00199 16 AE000511 Input sequences: #1 RHP00200 23 AE000511 #2 RHP00203 107 AE000511 Motif number 1 TAAGCCCTAATTAAGGAATGAAC 1 9 1 AATTAAGGAA 0.988088 -15 GTAGGCTTAAAATTCAGAAAGGGTGTTTTT 2 26 1 AATTCAGAAA 0.984542 -82 GAAAGGGTGTTTTTAAGCAAGATTAGGTTA 2 42 1 TTTTAAGCAA 0.975789 -66 ATTAATAAAATTTTAATAAAACTTGTGATT 2 73 0 TTTTAATAAA 0.967352 -35 CCTTCTCATTAATTAATAAAATTTTAATAA 2 84 0 AATTAATAAA 0.984314 -24 ********** Masking position 6 Map Score: 6.5895 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 103 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 2 ATTTTAAGCCTACATTCTCAGCGAATCA 2 9 0 TACATTCTCA 0.996967 -99 AAGATTAGGTTACAATCACAAGTTTTATTA 2 60 1 TACAATCACA 0.990562 -48 GATCCCTTCTCATTAATTAATA 2 96 0 TCCCTTCTCA 0.995716 -12 ********** Masking position 10 Map Score: 3.42432 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 11 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0