AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i303_mixed18_hpyl_reg_100.orf -o303_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01210 111 AE000511 #2 RHP01211 72 AE000511 #3 RHP01212 53 AE000511 Motif number 1 TTATTTAGCCAAAAACCATTTTGATCAAAG 1 41 1 AAAAACCATT 0.995697 -71 TAGAAGATTTAAAAAGGCTTTT 1 100 1 AAAAAGGCTT 0.990799 -12 GCGTTTTAAAAACCTTTGAGGGTTAAA 2 8 1 AAAAACCTTT 0.985861 -65 TTTAAAACTCAAAAAGGATTGATA 2 59 1 AAAAAGGATT 0.995697 -14 CTTTTTCAAAAATAACCATTTCTTGTCTTT 3 28 0 AATAACCATT 0.982893 -26 GTTATTTTTGAAAAAGGATTGA 3 42 1 AAAAAGGATT 0.995697 -12 ********** Masking position 5 Map Score: 14.3731 Number of sites scoring better than the average of aligned sites = 235 Number in coding regions = 183 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 2 ATGCTCTTGATTTTAGAGCTTTGATCAAAAT 1 58 0 TTTTAGACTT 0.984277 -54 AAAAGCCTTTTTAAATCTTCTAATAAATT 1 93 0 TTTTAAACTT 0.992855 -19 CCTCAAAGGTTTTTAAAACGC 2 1 0 TTTTAAACGC 0.99296 -72 TTTTACACTATTTTAACCCTCAAAGGTTTTT 2 18 0 TTTTAACCTC 0.99296 -55 ATAGTAAAGATTTTAAAACTCAAAAAGGATT 2 48 1 TTTTAAACTC 0.996816 -25 ******* *** Masking position 5 Map Score: 9.75683 Number of sites scoring better than the average of aligned sites = 235 Number in coding regions = 203 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 TCAAAGCTCTAAAATCAAGAGCATAGAAAA 1 65 1 AAAATCAAGA 0.987339 -47 ATAGTGTAAAATAGTAAAGATTTTAAAACT 2 38 1 ATAGTAAAGA 0.954932 -35 AAAGATTTTAAAACTCAAAAAGGATTGATA 2 53 1 AAACTCAAAA 0.966768 -20 TTATCCTAAAAAAGACAAGAAATGGTTATT 3 18 1 AAAGACAAGA 0.988261 -36 ********** Masking position 7 Map Score: 1.86124 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 151 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 GATCGTCATGGAGCATGAATGAGATGGCCTTT 1 11 1 GAGCTGAATA 0.948761 -101 CTTGATTTTAGAGCTTTGATCAAAATGGTTTT 1 52 0 GAGCTTGATA 0.97578 -60 CTAAAATCAAGAGCATAGAAAATTTATTAGAA 1 73 1 GAGCTAGAAA 0.988306 -39 GCGTTTTAAAAACCTTTGAGGG 2 1 1 GCGTTTAAAA 0.949483 -72 AGGGTTAAAATAGTGTAAAATAGTAAAGATTT 2 29 1 TAGTTAAAAA 0.942111 -44 AATCCTTTTTGAGTTTTAAAATCTTTACTATT 2 47 0 GAGTTTAAAT 0.926928 -26 GGTTTTGTTATCCTAAAAAAGACAAGAAAT 3 9 1 TATCTAAAAA 0.878613 -45 AAGAAATGGTTATTTTTGAAAAAGGATTGA 3 34 1 TATTTTGAAA 0.85466 -20 **** ***** * Masking position 9 Map Score: 5.06426 Number of sites scoring better than the average of aligned sites = 1886 Number in coding regions = 1704 Number in noncoding regions = 182 Number of orfs with sites within 600 bp upstream = 129 Fraction of orfs with sites within 600 bp upstream = 0.0207196 Motif number 5 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0