AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i307_mixed21_hpyl_reg_300.orf -o307_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01463 37 AE000511 #2 RHP01464 263 AE000511 Motif number 1 TTAATCCCATTAAATTAAAAATAGTGTC 1 20 1 TAATTAAAAA 0.798973 -18 TTTTAAGTTTAAATTTAAAAATAAAGGATACTT 2 12 0 AAATTAAAAA 0.79746 -252 TTTTAAATTTAAACTTAAAATTATAGCATAAGT 2 25 1 AAATTAAAAA 0.968037 -239 TAAGTCATAATAAATTAAAACCACTCTAAAGTT 2 53 1 TAATTAAAAA 0.989973 -211 AAACCACTCTAAAGTTAAATAAAATTTGACTTT 2 70 1 AAATTAAATA 0.930892 -194 AAAATTTGACTTTGTTAAAAAAATTATGATAGC 2 90 1 TTTTTAAAAA 0.934061 -174 AAGCTAAAGCATTCTTAAAAAATTAGTGTAACC 2 181 0 ATTTTAAAAT 0.798689 -83 TTGTTGCAATTAAGATAAAAATACAAAAAGCTA 2 208 0 TAAATAAAAA 0.945595 -56 GAAATCTCTTTTTGTTAAAAGGAAATTTA 2 245 1 TTTTTAAAAA 0.969173 -19 *** ****** * Masking position 7 Map Score: 15.3015 Number of sites scoring better than the average of aligned sites = 314 Number in coding regions = 201 Number in noncoding regions = 113 Number of orfs with sites within 600 bp upstream = 103 Fraction of orfs with sites within 600 bp upstream = 0.0165435 Motif number 2 CATAGCAAAGAATTACGAAATTCAACACTTGTGGCAT 2 122 1 AATACATCAA 0.991901 -142 AGATGCTAATAAGTGGCCCATGCCACAAGTGTTGAAT 2 141 0 AATGGATCAA 0.989102 -123 ATTCTTAAAAAATTAGTGTAACCAAAAGATGCTAATA 2 167 0 AATAGAACAA 0.991713 -97 ATTAAGATAAAAATACAAAAAGCTAAAGCATTCTTAA 2 196 0 AATACAACAA 0.994334 -68 TTTTTATCTTAATTGCAACAAACTAGAAATCTCTTTT 2 220 1 AATGCAACAA 0.994744 -44 ** *** ** * * * Masking position 10 Map Score: 3.38408 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 28 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 CAAGTATCCTTTATTTTTAAAT 2 2 1 AAGTTCCTTT 0.991929 -262 TATTTAACTTTAGAGTGGTTTTAATTTATTA 2 60 0 TAGATGGTTT 0.898762 -204 GGCCACTTATTAGCATCTTTTGGTTACACTA 2 160 1 TAGCTCTTTT 0.945009 -104 CTAATTTTTTAAGAATGCTTTAGCTTTTTGT 2 188 1 AAGATGCTTT 0.978063 -76 AACAAACTAGAAATCTCTTTTTGTTAAAAGG 2 236 1 AAATTCTTTT 0.910037 -28 TAAATTTCCTTTTAACAAAAAG 2 252 0 AAATTCCTTT 0.976054 -12 **** ****** Masking position 6 Map Score: 3.02619 Number of sites scoring better than the average of aligned sites = 254 Number in coding regions = 205 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 4 CACTATTTTTAATTTAATGGGATTAATTAGGG 1 14 0 AATTAATGGA 0.948946 -24 GTTTAAATTTAAAAATAAAGGATACTTG 2 7 0 AAAATAAAGA 0.820176 -257 GAGTGGTTTTAATTTATTATGACTTATGCTAT 2 47 0 AATTATTAGA 0.965049 -217 TCTAAAGTTAAATAAAATTTGACTTTGTTAAA 2 77 1 AATAAATTGA 0.916192 -187 GACTTTGTTAAAAAAATTATGATAGCATAGCA 2 97 1 AAAAATTAGA 0.971445 -167 ATAGCATAGCAAAGAATTACGAAATTCAACAC 2 118 1 AAAAATTAGA 0.971455 -146 TGGTTACACTAATTTTTTAAGAATGCTTTAGC 2 180 1 AATTTTTAGA 0.909994 -84 ATTTCCTTTTAACAAAAAGAGATTTCTAGTTT 2 239 0 AACAAAAGGA 0.831014 -25 *** ***** ** Masking position 2 Map Score: 4.24423 Number of sites scoring better than the average of aligned sites = 292 Number in coding regions = 225 Number in noncoding regions = 67 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 5 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0