AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i308_mixed22_hpyl_reg_300.orf -o308_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00800 59 AE000511 #2 RHP00801 100 AE000511 Motif number 1 TATTTTAACCCATTTTTTAGGAAACTC 1 43 1 CATTTTTGGA 0.993469 -17 AAACTCATCGCGCTTTTAGGGCCTAGCGGGAG 2 12 1 CGTTTTAGGC 0.997304 -89 ATAGAAAGAGCGCTTTTACCGCTCCCGCTAGG 2 33 0 CGTTTTACGC 0.990572 -68 TTTCAGCGTCCAATTCTTGGGCTAATTCAATA 2 62 0 CATTCTTGGC 0.997304 -39 ACGCTGAAATCTTTTCTTTGGATTCT 2 85 1 CTTTCTTGGA 0.989375 -16 ** ***** *** Masking position 7 Map Score: 6.68935 Number of sites scoring better than the average of aligned sites = 285 Number in coding regions = 264 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 AAAAAATGGGTTAAAATAGCCTTATTATAA 1 31 0 TTAAAATAGC 0.991 -29 CCGCTAGGCCCTAAAAGCGCGATGAGTTTC 2 11 0 CTAAAAGCGC 0.983223 -90 GCTAATTCAATAGAAAGAGCGCTTTTACCG 2 44 0 TAGAAAGAGC 0.990501 -57 GCTCTTTCTATTGAATTAGCCCAAGAATTG 2 54 1 TTGAATTAGC 0.985322 -47 ********** Masking position 5 Map Score: 3.32274 Number of sites scoring better than the average of aligned sites = 343 Number in coding regions = 320 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0