AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i002_Purine_Nucleotides_Metabolism_mgen_reg_300.orf -o002_mgen_300.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00101 91 Mycoplasma Motif number 1 CGTGCGCATAACGATGCTTGATAACATTG 1 10 1 AACGATGCTT 0.982372 -82 GATGCTTGATAACATTGCTTTGAACATGAT 1 23 1 AACATTGCTT 0.997709 -69 CATTGCTTTGAACATGATTTTTAATTATTT 1 35 1 AACATGATTT 0.988631 -57 GTTTTATTAAAACATTATTTAATAATAAAT 1 61 0 AACATTATTT 0.994692 -31 ATTGCAATATTGTTTTATTAAAACA 1 77 0 AATATTGTTT 0.988015 -15 ********** Masking position 2 Map Score: 10.6416 Number of sites scoring better than the average of aligned sites = 100 Number in coding regions = 96 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 AATAAATAATTAAAAATCATGTTCAAAGCA 1 38 0 TAAAAATCAT 0.960108 -54 ATTATTTAATAATAAATAATTAAAAATCAT 1 48 0 AATAAATAAT 0.954967 -44 ATTATTTATTATTAAATAATGTTTTAATAA 1 58 1 ATTAAATAAT 0.734689 -34 TAATGTTTTAATAAAACAATATTGCAAT 1 74 1 ATAAAACAAT 0.980304 -18 ********** Masking position 5 Map Score: 4.69653 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 69 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0