AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i013_Glycolysis___PPS_mgen_reg_300.orf -o013_mgen_300.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00209 112 Mycoplasma #2 RMG02317 20 Mycoplasma Motif number 1 GGTTATTCCAAAATACTTTGCATTGTTTTG 1 37 0 AAATACTTTG 0.984672 -76 ACCAGATAATAACTGCTTTTCCTCAAAAGA 1 64 1 AACTGCTTTT 0.937425 -49 TTTTCACTGTAACTTCTTTTGAGGAAAAGC 1 78 0 AACTTCTTTT 0.978417 -35 TACAGTGAAAAAATGATTTTAAGTTG 1 97 1 AAATGATTTT 0.75732 -16 AAACACTTTTGCAGTTGATT 2 11 0 AAACACTTTT 0.940866 -10 ********** Masking position 7 Map Score: 9.0199 Number of sites scoring better than the average of aligned sites = 156 Number in coding regions = 144 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 GACTGAAGCACTATCCCAAAG 1 2 0 CTATCCCAAA 0.986087 -111 GTGCTTCAGTCATTAGCAAAACAATGCAAA 1 21 1 CATTAGCAAA 0.93291 -92 TATTATCTGGTTATTCCAAAATACTTTGCA 1 45 0 TTATTCCAAA 0.956919 -68 AATAACTGCTTTTCCTCAAAAGAAGTTACA 1 71 1 TTTCCTCAAA 0.914459 -42 CAACTTAAAATCATTTTTTC 1 103 0 CAACTTAAAA 0.911925 -10 AATCAACTGCAAAAGTGTTT 2 4 1 CAACTGCAAA 0.990433 -17 ********** Masking position 8 Map Score: 3.99109 Number of sites scoring better than the average of aligned sites = 463 Number in coding regions = 416 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 ATTGTTTTGCTAATGACTGAAGCACTATCC 1 16 0 TAATGACTGA 0.985971 -97 AATAACCAGATAATAACTGCTTTTCCTCAA 1 60 1 TAATAACTGC 0.995643 -53 AATCAACTGCAAAAGTGTTT 2 1 1 AATCAACTGC 0.984091 -20 ********** Masking position 6 Map Score: 0.922323 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 38 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0