AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i038_Galactose_Metabolism__mgen_reg_300.orf -o038_mgen_300.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00209 112 Mycoplasma #2 RMG02317 20 Mycoplasma #3 RMG02322 24 Mycoplasma Motif number 1 CAAAACAATGCAAAGTATTTTGGAATAACC 1 37 1 CAAAGTATTT 0.983916 -76 TCTTTTGAGGAAAAGCAGTTATTATCTGGT 1 64 0 AAAAGCAGTT 0.941099 -49 GCTTTTCCTCAAAAGAAGTTACAGTGAAAA 1 78 1 AAAAGAAGTT 0.978609 -35 CAACTTAAAATCATTTTTTCACTGTA 1 97 0 AAAATCATTT 0.765577 -16 AATCAACTGCAAAAGTGTTT 2 11 1 AAAAGTGTTT 0.943113 -10 ********** Masking position 4 Map Score: 8.35462 Number of sites scoring better than the average of aligned sites = 156 Number in coding regions = 144 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 GACTGAAGCACTATCCCAAAG 1 1 0 CTATCCAAAG 0.979574 -112 CTTTGCATTGTTTTGCTAATGACTGAAGCAC 1 21 0 TTTTCTAATG 0.891971 -92 TATTATCTGGTTATTCCAAAATACTTTGCAT 1 44 0 TTATCCAAAA 0.977944 -69 ATAATAACTGCTTTTCCTCAAAAGAAGTTAC 1 69 1 CTTTCCTCAA 0.909207 -44 CTTAAAATCATTTTTTCACTGTAACTTCTTT 1 89 0 TTTTTCACTG 0.957493 -24 AGTTATTCCAATGCCTAATAAGG 3 12 0 TTATCCAATG 0.994146 -13 **** ****** Masking position 4 Map Score: 5.32041 Number of sites scoring better than the average of aligned sites = 166 Number in coding regions = 155 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 ATTGTTTTGCTAATGACTGAAGCACTATCC 1 16 0 TAATGACTGA 0.982956 -97 AATAACCAGATAATAACTGCTTTTCCTCAA 1 60 1 TAATAACTGC 0.994692 -53 AATCAACTGCAAAAGTGTTT 2 1 1 AATCAACTGC 0.980659 -20 ********** Masking position 6 Map Score: 0.523859 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 38 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0