AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i100_Ion_Transporter_mgen_reg_100.orf -o100_mgen_100.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RMG03444 167 Mycoplasma Input sequences: #1 RMG01751 167 Mycoplasma Motif number 1 CAAAAAATTCGTTGGGTAATAGTCTCACCT 1 54 1 GTTGGGTAAT 0.979025 -114 AAACTCACCACTTGGTTAAAAAAAATTGGC 1 86 0 CTTGGTTAAA 0.995019 -82 GACAAAACCAGATGGTAAAACTCACCACTT 1 103 0 GATGGTAAAA 0.987611 -65 ACCTTGGTAAAATTATATTTGA 1 156 0 CTTGGTAAAA 0.995019 -12 ********** Masking position 3 Map Score: 5.20802 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 46 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 AAATAACAGCAAACTTCCAAACAA 1 2 1 AAAACAAAAC 0.995408 -166 CAAACTTCCAAACAAGATGCAATAGATATAAAA 1 20 1 AAAAGACAAT 0.987986 -148 CAATAGATATAAAAACAAAAAATTCGTTGGGTA 1 39 1 AAAACAAAAT 0.992918 -129 TTTTAATGACAAGAAGACAAAACCAGATGGTAA 1 115 0 AAAAGAAAAC 0.99541 -53 ** **** **** Masking position 7 Map Score: 2.7483 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 36 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 GGCTGAGGTGAGACTATTACCCAACGAATTT 1 58 0 AGATATTACC 0.987357 -110 CTCAGCCAATTTTTTTTAACCAAGTGGTGAG 1 82 1 TTTTTTAACC 0.952383 -86 AACCAAGTGGTGAGTTTTACCATCTGGTTTT 1 99 1 TGATTTTACC 0.994958 -69 GCTATCAAATATAATTTTACCAAGGT 1 152 1 ATATTTTACC 0.992229 -16 *** ******* Masking position 5 Map Score: 2.64416 Number of sites scoring better than the average of aligned sites = 41 Number in coding regions = 37 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0