AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i193_dna_polymerase_mgen_reg_100.orf -o193_mgen_100.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02591 234 Mycoplasma Motif number 1 TTAAATTGTTAATAACAAAAAAATCTCTA 1 10 1 TAATAACAAA 0.981985 -225 AAAAAATCTCTATTAAAAAAACCAACTTTA 1 28 1 TATTAAAAAA 0.98829 -207 TGGGCGCATATATTAATAAATTTTATTAAT 1 149 1 TATTAATAAA 0.989294 -86 TTCTTGCTTATATTAATAAAATTTATTAAT 1 160 0 TATTAATAAA 0.989294 -75 GTTTAAATTCTAATAAAGAATTAGATTGTT 1 188 0 TAATAAAGAA 0.966904 -47 ********** Masking position 5 Map Score: 8.61806 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 75 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 TTAAATTGTTAATAACAAAA 1 1 1 TTAAATTGTT 0.974411 -234 TTTTTTTAATAGAGATTTTTTTGTTATTAA 1 19 0 AGAGATTTTT 0.907306 -216 AAAGTTGGTTTGAAATTCTAAATGGCGCGC 1 57 1 TGAAATTCTA 0.967679 -178 GCATATATTAATAAATTTTATTAATATAAG 1 154 1 ATAAATTTTA 0.860747 -81 TAATAAAGAATTAGATTGTTCTTGCTTATA 1 178 0 TTAGATTGTT 0.972124 -57 ATGAAATCGTTTAAATTCTAATAAAGAATT 1 196 0 TTAAATTCTA 0.972292 -39 ********** Masking position 5 Map Score: 5.81014 Number of sites scoring better than the average of aligned sites = 130 Number in coding regions = 112 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 CTATTAAAAAAACCAACTTTAAAGTTGGTT 1 37 1 AACCAACTTT 0.996435 -198 TAGAATTTCAAACCAACTTTAAAGTTGGTT 1 47 0 AACCAACTTT 0.996435 -188 ********** Masking position 5 Map Score: 2.0876 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TTCAAGTCCTATTGGGCGCGCCATTTAGAA 1 72 0 ATTGGGCGCG 0.985083 -163 ACCAGAAGGTTATGGGTTCAAGTCCTATTG 1 88 0 TATGGGTTCA 0.987573 -147 GGATAGAGTGTCTGGCTTCGGACCAGAAGG 1 109 0 TCTGGCTTCG 0.974712 -126 CCGATTGAGCTATGGGCGCATATATTAATA 1 137 1 TATGGGCGCA 0.994649 -98 ********** Masking position 3 Map Score: 1.2885 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 3 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 GCCATTTAGAATTTCAAACCAACTTTAAAG 1 53 0 ATTTCAAACC 0.96665 -182 GAAGGTTATGGGTTCAAGTCCTATTGGGCG 1 84 0 GGTTCAAGTC 0.984676 -151 TTGAACTATTAGATGAAATCGTTTAAATTC 1 208 0 AGATGAAATC 0.96874 -27 TTCATCTAATAGTTCAAATCACAT 1 221 1 AGTTCAAATC 0.994438 -14 ********** Masking position 6 Map Score: 2.08325 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 33 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 6 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0