AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_dna_replication_mgen_reg_300.orf -o194_mgen_300.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG03264 97 Mycoplasma #2 RMG03260 188 Mycoplasma Motif number 1 AGGTACATGCTAAAGAAAATATCTCTTTTTG 1 42 1 TAAAAAAATA 0.977479 -56 TGTTCTAGATTATCAAAAAGAGATATTTTCT 1 55 0 TATCAAAAGA 0.936012 -43 TCTATACATCTAAACAAATTAACAAAGCCAT 2 18 0 TAAAAAATTA 0.940528 -171 TAGATTTAAATATCGAAAATATCGAGAGAAT 2 45 1 TATCAAAATA 0.977404 -144 GAGAATTTATTAATAAAAATAAAAACTATAT 2 70 1 TAATAAAATA 0.973272 -119 TTATTACTTATAATAAATATAGTTTTTATTT 2 86 0 TAATAATATA 0.957825 -103 CGTTGAATTATAACAAAATTAGAAAACGGCT 2 155 0 TAACAAATTA 0.977404 -34 TAATTAATAAACACGTTGAAT 2 178 0 TAATAATAAA 0.853643 -11 **** ****** Masking position 6 Map Score: 10.6662 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 155 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 AAGATTAGCAATTAAAATTTGAAAGGTACA 1 19 1 ATTAAAATTT 0.924262 -79 GTACATGCTAAAGAAAATATCTCTTTTTGA 1 44 1 AAGAAAATAT 0.892887 -54 TATTTTCGATATTTAAATCTATACATCTAA 2 36 0 ATTTAAATCT 0.940224 -153 TATTTTTATTAATAAATTCTCTCGATATTT 2 61 0 AATAAATTCT 0.984531 -128 TATTAATAAAAATAAAAACTATATTTATTA 2 77 1 AATAAAAACT 0.966931 -112 GGTTAGAAGTAATAAATTCTCCTACTTACT 2 116 0 AATAAATTCT 0.984531 -73 ********** Masking position 5 Map Score: 5.84869 Number of sites scoring better than the average of aligned sites = 156 Number in coding regions = 130 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 GTTAATTTGTTTAGATGTATAGATTTAAAT 2 26 1 TTAGATGTAT 0.88081 -163 TCGAGAGAATTTATTAATAAAAATAAAAAC 2 66 1 TTATTAATAA 0.489972 -123 ACTATATTTATTATAAGTAATAAGTAAGTA 2 94 1 TTATAAGTAA 0.861066 -95 ATTGCCAAGGTTAGAAGTAATAAATTCTCC 2 124 0 TTAGAAGTAA 0.951149 -65 TCTAATTTTGTTATAATTCAACGTGTTTAT 2 163 1 TTATAATTCA 0.890958 -26 ********** Masking position 3 Map Score: 1.62516 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 85 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 4 ACCTTAAAGATTAGCAATTAAAATTTGAAA 1 13 1 TTAGCAATTA 0.984872 -85 GATATTTTCTTTAGCATGTACCTTTCAAAT 1 35 0 TTAGCATGTA 0.948015 -63 GTTTTTATTTTTATTAATAAATTCTCTCGA 2 66 0 TTATTAATAA 0.489273 -123 TTATAAGTAATAAGTAAGTAGGAGAATTTA 2 104 1 TAAGTAAGTA 0.906306 -85 ACTTCTAACCTTGGCAATGAGCCGTTTTCT 2 136 1 TTGGCAATGA 0.936223 -53 TTCAACGTGTTTATTAATTA 2 179 1 TTATTAATTA 0.604534 -10 ********** Masking position 6 Map Score: 2.68045 Number of sites scoring better than the average of aligned sites = 265 Number in coding regions = 248 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 5 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0