AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i209_rpod_mgen_reg_100.orf -o209_mgen_100.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG04660 44 Mycoplasma #2 RMG04657 19 Mycoplasma #3 RMG03599 178 Mycoplasma Motif number 1 AAGTTATATAAGCTAAAATT 1 1 1 AAGTTATATA 0.915272 -44 ATATAAGCTAAAATTATAATGCTAGTCGCA 1 16 1 AAATTATAAT 0.89774 -29 TTTTTAAGATTAATTAACA 2 6 1 AAGATTAATT 0.781212 -14 GCAAGTTAAAATATACTAAATA 3 3 1 AAGTTAAAAT 0.977184 -176 AACCTTGGCAAGGTTATGTTCTACCATTGA 3 57 0 AGGTTATGTT 0.958236 -122 AACCTTGCCAAGGTTAAGATGCGGGTTCGA 3 72 1 AGGTTAAGAT 0.9592 -107 TTTTACAAAGAAGTTTTAATTTGGAGCAGA 3 111 0 AAGTTTTAAT 0.967388 -68 ********** Masking position 1 Map Score: 6.22061 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 224 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 GCGACTAGCATTATAATTTTAGCTTATATA 1 15 0 TTATAATTTT 0.921549 -30 ACTTTAATATTTAGTATATTTTAACTTGC 3 10 0 TTAGTATATT 0.948642 -169 TTGATACCAATCAGGATTTTACAAAGAAGT 3 127 0 TCAGGATTTT 0.994947 -52 ATCAACTAAGTCAGGATTTTTCTTATTTAT 3 152 1 TCAGGATTTT 0.994947 -27 ********** Masking position 6 Map Score: 3.12742 Number of sites scoring better than the average of aligned sites = 40 Number in coding regions = 35 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 TTAGCTCAATGCGACTAGCAT 1 34 0 TAGCTCAATG 0.996686 -11 AACGCAGATATAGaTCAATGGTAGAACATA 3 43 1 TAGaTCAATG 0.995101 -136 ********** Masking position 5 Map Score: 0.750581 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 0 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: 4.07441e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 4.07441e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.07441e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0