AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i223_Pseudouridylate_Synthase_mgen_reg_100.orf -o223_mgen_100.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG01475 200 Mycoplasma Motif number 1 CTACTTGTATATTCAGTTAAAAT 1 4 1 CTTGTATATT 0.936034 -197 ATAATTTTTGTTAGTTAATTAGTGAATTTT 1 29 0 TTAGTTAATT 0.940157 -172 AGTTTAAAAACTAGTAAAAAAGTGTTAATA 1 66 0 CTAGTAAAAA 0.988097 -135 CTTAAAAAAGTTAGTTTAAAAACTAGTAAA 1 78 0 TTAGTTTAAA 0.970386 -123 AAGTGTAATCCTAGTTTAATTTCTGGTAGT 1 105 1 CTAGTTTAAT 0.970102 -96 CAAGTAGCTATTAGTAAAGAAAACTACCAG 1 127 0 TTAGTAAAGA 0.959498 -74 CTAATAGCTACTTGTAAAAAATTAAAAGTT 1 143 1 CTTGTAAAAA 0.966513 -58 ATGGCACTATTTAGTATATAGATATCAGGC 1 180 1 TTAGTATATA 0.97582 -21 ********** Masking position 8 Map Score: 12.976 Number of sites scoring better than the average of aligned sites = 141 Number in coding regions = 117 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 CTACTTGTATATTCAGTTAA 1 1 1 CTACTTGTAT 0.871847 -200 TTTTGTTAGTTAATTAGTGAATTTTAACTG 1 24 0 TAATTAGTGA 0.862628 -177 TAACTAACAAAAATTATTAAGGAGTATTAA 1 42 1 AAATTATTAA 0.888576 -159 GTTAGTTTAAAAACTAGTAAAAAAGTGTTA 1 69 0 AAACTAGTAA 0.718841 -132 ACCAGAAATTAAACTAGGATTACACTTAAA 1 102 0 AAACTAGGAT 0.869982 -99 TTACAAGTAGCTATTAGTAAAGAAAACTAC 1 130 0 CTATTAGTAA 0.920634 -71 TTACTAATAGCTACTTGTAAAAAATTAAAA 1 140 1 CTACTTGTAA 0.920687 -61 CCATTAATTCTAACTTTTAATTTTTTACAA 1 154 0 TAACTTTTAA 0.897269 -47 ********** Masking position 3 Map Score: 7.43624 Number of sites scoring better than the average of aligned sites = 468 Number in coding regions = 430 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 TAGTGAATTTTAACTGAATATACAAGTAG 1 10 0 TAACTGAATA 0.820607 -191 TATTCAGTTAAAATTCACTAATTAACTAAC 1 20 1 AAATTCACTA 0.885416 -181 ATTCACTAATTAACTAACAAAAATTATTAA 1 32 1 TAACTAACAA 0.947564 -169 ACTAGTTTTTAAACTAACTTTTTTAAGTGT 1 81 1 AAACTAACTT 0.970913 -120 AAACTACCAGAAATTAAACTAGGATTACAC 1 107 0 AAATTAAACT 0.792326 -94 TTAGTAAAGAAAACTACCAGAAATTAAACT 1 117 0 AAACTACCAG 0.915924 -84 TACTTGTAAAAAATTAAAAGTTAGAATTAA 1 151 1 AAATTAAAAG 0.909791 -50 TGATATCTATATACTAAATAGTGCCATTAA 1 177 0 ATACTAAATA 0.878964 -24 ********** Masking position 3 Map Score: 2.09441 Number of sites scoring better than the average of aligned sites = 1095 Number in coding regions = 985 Number in noncoding regions = 110 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 4 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0