AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i223_Pseudouridylate_Synthase_mgen_reg_300.orf -o223_mgen_300.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG01475 200 Mycoplasma Motif number 1 CTACTTGTATATTCAGTTAAAAT 1 4 1 CTTGTATATT 0.938705 -197 ATAATTTTTGTTAGTTAATTAGTGAATTTT 1 29 0 TTAGTTAATT 0.942666 -172 AGTTTAAAAACTAGTAAAAAAGTGTTAATA 1 66 0 CTAGTAAAAA 0.988614 -135 CTTAAAAAAGTTAGTTTAAAAACTAGTAAA 1 78 0 TTAGTTTAAA 0.971662 -123 AAGTGTAATCCTAGTTTAATTTCTGGTAGT 1 105 1 CTAGTTTAAT 0.971394 -96 CAAGTAGCTATTAGTAAAGAAAACTACCAG 1 127 0 TTAGTAAAGA 0.961226 -74 CTAATAGCTACTTGTAAAAAATTAAAAGTT 1 143 1 CTTGTAAAAA 0.967793 -58 ATGGCACTATTTAGTATATAGATATCAGGC 1 180 1 TTAGTATATA 0.976867 -21 ********** Masking position 8 Map Score: 12.976 Number of sites scoring better than the average of aligned sites = 141 Number in coding regions = 117 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 TTAACTGAATATACAAGTAG 1 1 0 ATACAAGTAG 0.874268 -200 CAGTTAAAATTCACTAATTAACTAACAAAA 1 24 1 TCACTAATTA 0.8488 -177 TTAATACTCCTTAATAATTTTTGTTAGTTA 1 42 0 TTAATAATTT 0.876383 -159 TAACACTTTTTTACTAGTTTTTAAACTAAC 1 69 1 TTACTAGTTT 0.732456 -132 TTTAAGTGTAATCCTAGTTTAATTTCTGGT 1 102 1 ATCCTAGTTT 0.861682 -99 GTAGTTTTCTTTACTAATAGCTACTTGTAA 1 130 1 TTACTAATAG 0.92253 -71 TTTTAATTTTTTACAAGTAGCTATTAGTAA 1 140 0 TTACAAGTAG 0.924703 -61 TTGTAAAAAATTAAAAGTTAGAATTAATGG 1 154 1 TTAAAAGTTA 0.886228 -47 ********** Masking position 6 Map Score: 7.43624 Number of sites scoring better than the average of aligned sites = 475 Number in coding regions = 436 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 TGTATATTCAGTTAAAATTCACTAATTAAC 1 16 1 GTTAAAATTC 0.984069 -185 GTAAAAAAGTGTTAATACTCCTTAATAATT 1 53 0 GTTAATACTC 0.95715 -148 ACTTAAAAAAGTTAGTTTAAAAACTAGTAA 1 79 0 GTTAGTTTAA 0.890326 -122 TGTAATCCTAGTTTAATTTCTGGTAGTTTT 1 108 1 GTTTAATTTC 0.938411 -93 TTTAATTTCTGGTAGTTTTCTTTACTAATA 1 119 1 GGTAGTTTTC 0.972658 -82 AAAATTAAAAGTTAGAATTAATGGCACTAT 1 160 1 GTTAGAATTA 0.970539 -41 ********** Masking position 3 Map Score: 4.46913 Number of sites scoring better than the average of aligned sites = 161 Number in coding regions = 143 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0