AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i224_Holliday_Junction_enzyme_mgen_reg_100.orf -o224_mgen_100.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG01870 300 Mycoplasma Motif number 1 GTGCATTCTATATGCTTGTCTTTT 1 1 0 TATTTGTTTT 0.976936 -300 GTGAGAAACTAATAAATTTGATTTTTCAAATTGG 1 55 1 AATATTTTTT 0.938581 -246 TATTGAAACTTATCATACTACTTTAATAAGATTC 1 95 1 TATTACTTTT 0.939417 -206 TGCCCTCCATTATTTTTTTGATTTGATCCCTTGC 1 153 0 TATTTTTTTT 0.992788 -148 AGATAGATGTAATCATTTTTATTTGCCCTCCATT 1 176 0 AATTTTTTTT 0.988467 -125 TGTGCTCAACAATTATTTTTCTTTTGCCTACAAA 1 224 0 AATTTTTTTT 0.988467 -77 CACAACTGGATTTCATATTGATTTAATACAAAAG 1 254 1 TTTTATTTTT 0.900311 -47 TTTTCAAATTTATGGTTTTCTTTTGTATTAAATC 1 273 0 TATTTTTTTT 0.992788 -28 *** **** *** Masking position 9 Map Score: 11.8731 Number of sites scoring better than the average of aligned sites = 115 Number in coding regions = 101 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 AGCATCACCAATTTGAAAAATCAAATTTAT 1 66 0 ATTTGAAAAA 0.950281 -235 ATTGGTGATGCTATTGAAACTTATCATACT 1 84 1 CTATTGAAAC 0.940619 -217 ATGCTTGGGAATTTTGAATCTTATTAAAGT 1 114 0 ATTTTGAATC 0.950001 -187 TTACATCTATCTTTGGAAAAGTTACTTTTG 1 198 1 CTTTGGAAAA 0.95459 -103 TATTAAATCAATATGAAATCCAGTTGTGCT 1 252 0 ATATGAAATC 0.962692 -49 GTTTTCTTTTGTATTAAATCAATATGAAAT 1 263 0 GTATTAAATC 0.835252 -38 AAAACCATAAATTTGAAAAAAAT 1 288 1 ATTTGAAAAA 0.950281 -13 ********** Masking position 7 Map Score: 4.90457 Number of sites scoring better than the average of aligned sites = 262 Number in coding regions = 242 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 GACAAGCATATAGAATGCACTGTCAAAGAC 1 15 1 TAGAATGCAC 0.93294 -286 CAAGCATTGTTTGAATGCAAGGGATCAAAT 1 137 1 TTGAATGCAA 0.793302 -164 AAAAAAATAATGGAGGGCAAATAAAAATGA 1 168 1 TGGAGGGCAA 0.980119 -133 AAAGTTACTTTTGTAGGCAAAAGAAAAATA 1 215 1 TTGTAGGCAA 0.843291 -86 AAAATAATTGTTGAGCACAACTGGATTTCA 1 239 1 TTGAGCACAA 0.681453 -62 TTCATATTGATTTAATACAAAAGAAAACCA 1 265 1 TTTAATACAA 0.83426 -36 ********** Masking position 9 Map Score: 3.65664 Number of sites scoring better than the average of aligned sites = 79 Number in coding regions = 72 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 GCACTGTCAAAGACAATTTTGGTCGTGAGAAACT 1 31 1 AGAAATTGGC 0.982257 -270 CCTTGCATTCAAACAATGCTTGGGAATTTTGAAT 1 125 0 AAAAATTTGG 0.994009 -176 GATCAAATCAAAAAAATAATGGAGGGCAAATAAA 1 159 1 AAAAATTGGG 0.996104 -142 GGCAAAAGAAAAATAATTGTTGAGCACAACTGGA 1 230 1 AAAAATTTGG 0.994011 -71 *** *** *** * Masking position 7 Map Score: 0.972355 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 19 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0