AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i224_Holliday_Junction_enzyme_mgen_reg_300.orf -o224_mgen_300.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG01870 300 Mycoplasma Motif number 1 AAAAGACAAGCATATAGAATGCAC 1 1 1 AAAACAAATA 0.978549 -300 CCAATTTGAAAAATCAAATTTATTAGTTTCTCAC 1 55 0 AAAAAATATT 0.942667 -246 GAATCTTATTAAAGTAGTATGATAAGTTTCAATA 1 95 0 AAAAGTAATA 0.943502 -206 GCAAGGGATCAAATCAAAAAAATAATGGAGGGCA 1 153 1 AAAAAAAATA 0.9933 -148 AATGGAGGGCAAATAAAAATGATTACATCTATCT 1 176 1 AAAAAAAATT 0.98928 -125 TTTGTAGGCAAAAGAAAAATAATTGTTGAGCACA 1 224 1 AAAAAAAATT 0.98928 -77 CTTTTGTATTAAATCAATATGAAATCCAGTTGTG 1 254 0 AAAAATAAAA 0.906771 -47 GATTTAATACAAAAGAAAACCATAAATTTGAAAA 1 273 1 AAAAAAAATA 0.9933 -28 *** **** *** Masking position 6 Map Score: 11.8731 Number of sites scoring better than the average of aligned sites = 115 Number in coding regions = 101 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 AGCATCACCAATTTGAAAAATCAAATTTAT 1 66 0 ATTTGAAAAA 0.946912 -235 ATTGGTGATGCTATTGAAACTTATCATACT 1 84 1 CTATTGAAAC 0.935998 -217 ATGCTTGGGAATTTTGAATCTTATTAAAGT 1 114 0 ATTTTGAATC 0.946111 -187 TTACATCTATCTTTGGAAAAGTTACTTTTG 1 198 1 CTTTGGAAAA 0.950869 -103 TATTAAATCAATATGAAATCCAGTTGTGCT 1 252 0 ATATGAAATC 0.959556 -49 GTTTTCTTTTGTATTAAATCAATATGAAAT 1 263 0 GTATTAAATC 0.825426 -38 AAAACCATAAATTTGAAAAAAAT 1 288 1 ATTTGAAAAA 0.946912 -13 ********** Masking position 7 Map Score: 4.90457 Number of sites scoring better than the average of aligned sites = 262 Number in coding regions = 242 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 GACAAGCATATAGAATGCACTGTCAAAGAC 1 15 1 TAGAATGCAC 0.933575 -286 CAAGCATTGTTTGAATGCAAGGGATCAAAT 1 137 1 TTGAATGCAA 0.792122 -164 AAAAAAATAATGGAGGGCAAATAAAAATGA 1 168 1 TGGAGGGCAA 0.980307 -133 AAAGTTACTTTTGTAGGCAAAAGAAAAATA 1 215 1 TTGTAGGCAA 0.842557 -86 AAAATAATTGTTGAGCACAACTGGATTTCA 1 239 1 TTGAGCACAA 0.680558 -62 TTCATATTGATTTAATACAAAAGAAAACCA 1 265 1 TTTAATACAA 0.835063 -36 ********** Masking position 9 Map Score: 3.65664 Number of sites scoring better than the average of aligned sites = 79 Number in coding regions = 72 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 GCACTGTCAAAGACAATTTTGGTCGTGAGAAACT 1 31 1 AGAAATTGGC 0.980552 -270 CCTTGCATTCAAACAATGCTTGGGAATTTTGAAT 1 125 0 AAAAATTTGG 0.99341 -176 GATCAAATCAAAAAAATAATGGAGGGCAAATAAA 1 159 1 AAAAATTGGG 0.995717 -142 GGCAAAAGAAAAATAATTGTTGAGCACAACTGGA 1 230 1 AAAAATTTGG 0.993411 -71 *** *** *** * Masking position 7 Map Score: 0.972355 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 19 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0