AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i225_Glutamyl_tRNA_synthase_mgen_reg_100.orf -o225_mgen_100.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG01274 119 Mycoplasma Motif number 1 TGAGACTTAAAATATTTGATCGCACAA 1 8 0 AATATTTGAT 0.988558 -112 GTCTCAGGGCGATACTTGATAAAAAACCTA 1 32 1 GATACTTGAT 0.993761 -88 CTATCTTTGCATTAATTGATGTTAAAACAT 1 74 0 ATTAATTGAT 0.793342 -46 TAAAAAATTACTTGATTTATTCAGTT 1 104 0 ATTACTTGAT 0.973747 -16 ********** Masking position 6 Map Score: 8.37625 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 13 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 TAAAATATTTGATCGCACAA 1 1 0 GATCGCACAA 0.992544 -119 TTTTATCAAGTATCGCCCTGAGACTTAAAA 1 26 0 TATCGCCCTG 0.986404 -94 AAACATCGTTAATGGCACTAGGTTTTTTAT 1 50 0 AATGGCACTA 0.982654 -70 TTAATGCAAAGATAGAACTGAATAAATCAA 1 89 1 GATAGAACTG 0.979677 -31 ********** Masking position 3 Map Score: 2.16235 Number of sites scoring better than the average of aligned sites = 19 Number in coding regions = 18 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 CCCTGAGACTTAAAATATTTGATCGCACAA 1 11 0 TAAAATATTT 0.927598 -109 CGATACTTGATAAAAAACCTAGTGCCATTA 1 41 1 TAAAAAACCT 0.979536 -79 TAATTGATGTTAAAACATCGTTAATGGCAC 1 62 0 TAAAACATCG 0.981194 -58 AGATAGAACTGAATAAATCAAGTAATTTTT 1 98 1 GAATAAATCA 0.933285 -22 TAAAAAATTACTTGATTTAT 1 110 0 TAAAAAATTA 0.961015 -10 ********** Masking position 5 Map Score: 2.97353 Number of sites scoring better than the average of aligned sites = 302 Number in coding regions = 275 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 4 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0