AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i232_formulase_mgen_reg_300.orf -o232_mgen_300.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG01880 63 Mycoplasma #2 RMG02914 110 Mycoplasma Motif number 1 TTAGGTTATTAATTAGTTTTAGAG 1 1 1 TTAGTTTTAT 0.989083 -63 TTAGAGTATATTATTATCTTGATTATATTGTAAC 1 29 1 TTATATTTAT 0.982794 -35 AACAACTTTTTTACGATAATGATTTTGAAATTTG 2 11 1 TTAGATATAT 0.995216 -100 TATTTTATTGTTACGATGATTAATTTTGTCTGGC 2 60 0 TTAGATATAT 0.995216 -51 AAATAGTACCTTCTGATGTTAAGTCTTTTTGT 2 89 1 TTCGATTTAT 0.992608 -22 *** *** ** * * Masking position 7 Map Score: 6.23394 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 27 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 TTAGGTTATTAATTAGTTTTAGAGTAT 1 8 1 ATTAATTAGT 0.919707 -56 AATCAAGATAATAATATACTCTAAAACTAA 1 23 0 ATAATATACT 0.739221 -41 TATTATCTTGATTATATTGTAACTAGAACC 1 40 1 ATTATATTGT 0.899172 -24 CATTATCGTAAAAAAGTTGTT 2 2 0 AAAAAGTTGT 0.884915 -109 ATAATGATTTTGAAATTTGTGCTGTTGTAA 2 26 1 TGAAATTTGT 0.87718 -85 GTTACGATGATTAATTTTGTCTGGCTGAGT 2 55 0 TTAATTTTGT 0.945783 -56 CATCGTAACAATAAAATAGTACCTTCTGAT 2 76 1 ATAAAATAGT 0.946503 -35 ********** Masking position 4 Map Score: 4.98746 Number of sites scoring better than the average of aligned sites = 315 Number in coding regions = 274 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 ATATGGTTCTAGTTACAATATAATCAAGAT 1 44 0 AGTTACAATA 0.988254 -20 TGTCTGGCTGAGTTACAACAGCACAAATTT 2 38 0 AGTTACAACA 0.988415 -73 AATTAATCATCGTAACAATAAAATAGTACC 2 69 1 CGTAACAATA 0.992517 -42 ACAAAAAGACTTAACATCAGAAGGTACTA 2 92 0 CTTAACATCA 0.953459 -19 ********** Masking position 5 Map Score: 4.26926 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 19 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ********** No masking Map Score: 4.35863e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 4.35863e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.35863e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0