AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i334_1_mgen_reg_300.orf -o334_mgen_300.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00500 178 Mycoplasma #2 RMG01559 106 Mycoplasma #3 RMG02580 151 Mycoplasma #4 RMG02581 45 Mycoplasma Motif number 1 CTATAAATAAGAAAAATCCTGACTTAGTTG 1 16 1 GAAAAATCCT 0.821127 -163 AAACTTCTTTGTAAAATCCTGATTGGTATC 1 45 0 GTAAAATCCT 0.897449 -134 TCTGCTCCAAATTAAAACTTCTTTGTAAAA 1 59 0 ATTAAAACTT 0.908689 -120 TCGAACCCGCATCTTAACCTTGGCAAGGTT 1 98 1 ATCTTAACCT 0.91895 -81 TCAATGGTAGAACATAACCTTGCCAAGGTT 1 113 0 AACATAACCT 0.949494 -66 TATTTAGTATATTTTAACTTGC 1 167 1 ATTTTAACTT 0.622454 -12 AACAAAACCTAACCTTGATC 2 1 1 AACAAAACCT 0.972889 -106 CCAATTTATGATAAAAACTTAGTTAAATTG 3 45 1 ATAAAAACTT 0.948894 -107 CTAAAACTAGATAAAAACCTAGCAATTTAA 3 67 0 ATAAAAACCT 0.982655 -85 ********** Masking position 6 Map Score: 8.34723 Number of sites scoring better than the average of aligned sites = 333 Number in coding regions = 294 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 GCAGATAACGGGAATCGAACCCGCATCTTA 1 84 1 GGAATCGAAC 0.996692 -95 TGATTTTCTTGAAATTGATCAAGGTTAGGT 2 17 0 GAAATTGATC 0.955264 -90 CTTCCCTAGAGGAGTTGAACCTCTATTTAC 3 14 0 GGAGTTGAAC 0.992111 -138 TAAAAACCTAGCAATTTAACTAAGTTTTTA 3 56 0 GCAATTTAAC 0.952275 -96 GTGGAAGGAATCGAACCCACACAGAC 3 136 0 GGAATCGAAC 0.996692 -16 ********** Masking position 5 Map Score: 6.41802 Number of sites scoring better than the average of aligned sites = 30 Number in coding regions = 15 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 GGATTTTTCTTATTTATAGTAGTG 1 5 0 TATTTATAGT 0.909457 -174 TGATCAAGGTTAGGTTTTGTT 2 2 0 TAGGTTTTGT 0.868228 -105 TTATGAGCATTAGTAATTGGTACTGATTTT 2 72 1 TAGTAATTGG 0.928788 -35 GTTGAACCTCTATTTACTGA 3 1 0 TATTTACTGA 0.876602 -151 GGTTTTTATCTAGTTTTAGGGGGTGTAGTT 3 78 1 TAGTTTTAGG 0.954522 -74 AATATATTAATATTTATTGGTCTTTGTCAA 4 18 1 TATTTATTGG 0.98114 -28 CTTATTTTTTGACAAAGACCAA 4 34 0 TATTTTTTGA 0.946616 -12 ********** Masking position 2 Map Score: 3.15445 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 145 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 4 TACAAAGAAGTTTTAATTTGGAGCAGATAA 1 62 1 TTTTAATTTG 0.917443 -117 AAATAATTTCTTTTGATTTTCTTGAAATTG 2 30 0 TTTTGATTTT 0.986889 -77 AAAAGAAATTATTTGATTTTTTAGCGTTAT 2 46 1 ATTTGATTTT 0.967522 -61 TTGGTACTGATTTTGAGTTTAATAACGTG 2 88 1 TTTTGAGTTT 0.977853 -19 ********** Masking position 6 Map Score: 1.91192 Number of sites scoring better than the average of aligned sites = 97 Number in coding regions = 77 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 GGCAAGGTTATGTTCTACCATTGAaCTATA 1 119 1 TGTTCTACCA 0.964648 -60 TGGAGACTGTTGTTCTACCACTAAACTACA 3 101 0 TGTTCTACCA 0.964648 -51 ********** Masking position 6 Map Score: 1.08419 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 5 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 6 AAAAATCCTGACTTAGTTGATACCAATCAG 1 27 1 ACTTAGTTGA 0.956554 -152 AATTAAAACTTCTTTGTAAAATCCTGATTG 1 50 0 TCTTTGTAAA 0.955114 -129 TATGATAAAAACTTAGTTAAATTGCTAGGT 3 51 1 ACTTAGTTAA 0.974051 -101 TATTTATTGGTCTTTGTCAAAAAATAAG 4 28 1 TCTTTGTCAA 0.969277 -18 ********** Masking position 4 Map Score: 0.50397 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 48 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 7 TAACGGGAATCGAACCCGCATCTTAACCTT 1 89 1 CGAACCCGCA 0.998126 -90 TGGAAGGAATCGAACCCACACAGACAGTTT 3 131 0 CGAACCCACA 0.99723 -21 ********** Masking position 4 Map Score: 0.429934 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 0 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 8 ********** No masking Map Score: 8.33767e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 8.33767e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 8.33767e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0