AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i004_4_1_1_21_mjan_reg_100.orf -o004_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ15216 108 M_jannaschii_chromosome Motif number 1 TTATAGAGTAAGCTATAAAATATCAGGAGGGAT 1 14 0 AGTTAAAATT 0.964896 -95 AAAACTAATTATAAATAAATTATGGTTTTGATT 1 45 0 ATATAAATTT 0.839447 -64 ATTTATAATTAGTTTTAAAATCTCTTACATAAA 1 62 1 AGTTAAAATT 0.602083 -47 TTCACCAAAAAGGTCTAAATTTTTATGTAAGAG 1 83 0 AGTTAAATTT 0.994087 -26 ** * ****** * Masking position 7 Map Score: 5.02632 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 59 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 ATTATAGAGTAAGCTATAAAATATCAGGAG 1 18 0 AAGCTATAAA 0.958463 -91 TTTATAGCTTACTCTATAATCAAAACCATA 1 28 1 ACTCTATAAT 0.960536 -81 TCTATAATCAAAACCATAATTTATTTATAA 1 40 1 AAACCATAAT 0.982239 -69 ATTTTAAAACTAATTATAAATAAATTATGG 1 53 0 TAATTATAAA 0.902663 -56 AAAATCTCTTACATAAAAATTTAGACCTTT 1 78 1 ACATAAAAAT 0.852348 -31 CTTTTCACCAAAAAGGTCTAAATT 1 95 0 TCACCAAAAA 0.961507 -14 ********** Masking position 6 Map Score: 2.68583 Number of sites scoring better than the average of aligned sites = 1593 Number in coding regions = 1267 Number in noncoding regions = 326 Number of orfs with sites within 600 bp upstream = 314 Fraction of orfs with sites within 600 bp upstream = 0.0504337 Motif number 3 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0