AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i021_Succinyl-CoA_Synthetase_mjan_reg_300.orf -o021_mjan_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ05733 98 M_jannaschii_chromosome #2 RMJ03497 300 M_jannaschii_chromosome Motif number 1 AAAAAATTTGGTGATAAATTTATAGGTTTAA 1 22 0 GTGTAAATTT 0.922366 -77 AAATTATCATATAAAAAATTTGGTGATAAAT 1 34 0 ATAAAAATTT 0.979828 -65 AATTTTTTATATGATAATTTTAAAATTTTGC 1 45 1 ATGTAATTTT 0.963831 -54 TTTCTTTTTAATGCAAAATTTTAAAATTATC 1 57 0 ATGAAAATTT 0.984289 -42 ATCACCTTAAATGATAAATTTCTTTTTAATG 1 75 0 ATGTAAATTT 0.980679 -24 CGTCATTCCAATAGTAGATTTATTCCTGTGA 2 156 0 ATATAGATTT 0.902228 -145 CCTTATAAATATATAAATTGTGAAAGTTCTA 2 209 1 ATAAAATTGT 0.925738 -92 ACAACGACACATATAAAAAGTAAAAGGGGAT 2 239 1 ATAAAAAAGT 0.789458 -62 AAAAGGGGATATATAAATTTTACGGTTTAAT 2 260 1 ATAAAATTTT 0.962235 -41 *** ******* Masking position 6 Map Score: 11.4936 Number of sites scoring better than the average of aligned sites = 515 Number in coding regions = 349 Number in noncoding regions = 166 Number of orfs with sites within 600 bp upstream = 157 Fraction of orfs with sites within 600 bp upstream = 0.0252168 Motif number 2 CACCGACAACATTAAACCTATAAATTTAT 1 5 1 GACACAACCT 0.986691 -94 GCTGGACCACGGCAGGAGAAATCCCTGGACCTGGG 2 51 0 GGCAGAACCC 0.997616 -250 GCGCCCTATAGGCAACTGGAGTCCCCGATGATAGA 2 84 1 GGCACTACCC 0.995617 -217 TGATAGACCTGGCTACACCACACCCCCGCATCAAT 2 112 1 GGCTCAACCC 0.996772 -189 ATCTACTATTGGAATGACGATACCCTTTAGGCATC 2 168 1 GGAAGAACCC 0.991299 -133 ATACCCTTTAGGCATCAAAGTGCCTTATAAATATA 2 187 1 GGCACAGCCT 0.994072 -114 **** ** * *** Masking position 13 Map Score: 8.26033 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 14 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 AAAATGGTGGGGGTGCTGGGATTTGAACCC 2 24 1 GGGTGCTGGG 0.99327 -277 GAGAAATCCCTGGACCTGGGTTCAAATCCC 2 41 0 TGGACCTGGG 0.981209 -260 TCTCCTGCCGTGGTCCAGCGCCCTATAGGC 2 67 1 TGGTCCAGCG 0.990214 -234 TGCGGGGGTGTGGTGTAGCCAGGTCTATCA 2 112 0 TGGTGTAGCC 0.9375 -189 GATTCTACATTGATGCGGGGGTGTGGTGTA 2 125 0 TGATGCGGGG 0.973507 -176 GTTTAATACATGGTGTTGAGGGATAAA 2 284 1 TGGTGTTGAG 0.971783 -17 ********** Masking position 8 Map Score: 4.31058 Number of sites scoring better than the average of aligned sites = 100 Number in coding regions = 76 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 4 GGTCCAGCGCCCTATAGGCAACTGGAGTCC 2 78 1 CCTATAGGCA 0.995579 -223 GAATAAATCTACTATTGGAATGACGATACC 2 162 1 ACTATTGGAA 0.94496 -139 ATGACGATACCCTTTAGGCATCAAAGTGCC 2 181 1 CCTTTAGGCA 0.992231 -120 ********** Masking position 10 Map Score: 0.379422 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 9 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0