AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i042_Transketolase_mjan_reg_100.orf -o042_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ00065 39 M_jannaschii_chromosome #2 RMJ03270 23 M_jannaschii_chromosome #3 RMJ00927 156 M_jannaschii_chromosome Motif number 1 ATAATTAATTTATTATTTTTGTTT 1 5 0 TATTATTTTT 0.995829 -35 ATAATAAATTAATTATTTTGGGTGAAAAAT 1 19 1 AATTATTTTG 0.974806 -21 AATTTTATTTTTTGGTGATTTA 2 3 1 TTTTATTTTT 0.990652 -21 ATTTACTATCTATTATTTTTAGGTGTAAGT 3 20 1 TATTATTTTT 0.995829 -137 TATGACTAACAATTATTTTAGCATAACATC 3 56 1 AATTATTTTA 0.962415 -101 ATTATGGATTTTTTGTTTTTGCTTTTTTTA 3 86 1 TTTTGTTTTT 0.970256 -71 TGAGTAATGATATTATTTTTTAAATCTTAA 3 125 1 TATTATTTTT 0.995829 -32 ********** Masking position 6 Map Score: 18.7141 Number of sites scoring better than the average of aligned sites = 639 Number in coding regions = 389 Number in noncoding regions = 250 Number of orfs with sites within 600 bp upstream = 215 Fraction of orfs with sites within 600 bp upstream = 0.0345326 Motif number 2 AATTAATTATTTTGGGTGAAAAATC 1 25 1 TTTGGGTGAA 0.950811 -15 AATTTTATTTTTTGGTGATTTAA 2 10 1 TTTTGGTGAT 0.977227 -14 ATCTATTATTTTTAGGTGTAAGTTTTAAAT 3 27 1 TTTAGGTGTA 0.977215 -130 TAACAATTATTTTAGCATAACATCATTATG 3 62 1 TTTAGCATAA 0.785091 -95 CATAACATCATTATGGATTTTTTGTTTTTG 3 77 1 TTATGGATTT 0.880727 -80 GATTTTTTGTTTTTGCTTTTTTTATTAATT 3 92 1 TTTTGCTTTT 0.951134 -65 GTTTCACCTTTTTAAGATTTAAAAAATAAT 3 136 0 TTTAAGATTT 0.821981 -21 ********** Masking position 2 Map Score: 3.59382 Number of sites scoring better than the average of aligned sites = 1756 Number in coding regions = 1504 Number in noncoding regions = 252 Number of orfs with sites within 600 bp upstream = 224 Fraction of orfs with sites within 600 bp upstream = 0.0359782 Motif number 3 AAACAAAAATAATAAATTAATTATTTTGG 1 10 1 TAATAAATTA 0.713928 -30 TTAAATCACCAAAAAATAAAATT 2 5 0 CAAAAAATAA 0.89226 -19 CCTCTATTTACTATCTATTATTTTTAGGTG 3 15 1 CTATCTATTA 0.928741 -142 TTAGTCATATTTAAAACTTACACCTAAAAA 3 35 0 TTAAAACTTA 0.944443 -122 TTAAATATGACTAACAATTATTTTAGCATA 3 51 1 CTAACAATTA 0.977585 -106 TATCATTACTCAATGAATTAATAAAAAAAG 3 107 0 CAATGAATTA 0.930835 -50 ATATTATTTTTTAAATCTTAAAAAGGTGAA 3 134 1 TTAAATCTTA 0.875445 -23 ********** Masking position 3 Map Score: 4.48271 Number of sites scoring better than the average of aligned sites = 851 Number in coding regions = 595 Number in noncoding regions = 256 Number of orfs with sites within 600 bp upstream = 246 Fraction of orfs with sites within 600 bp upstream = 0.0395117 Motif number 4 TTAATTATTTTGGGTGAAAAATC 1 27 1 TGGGTGAAAA 0.988982 -13 CTATTATTTTTAGGTGTAAGTTTTAAATAT 3 29 1 TAGGTGTAAG 0.988982 -128 AAATCTTAAAAAGGTGAAACT 3 146 1 AAGGTGAAAC 0.988982 -11 ********** Masking position 8 Map Score: 0.282824 Number of sites scoring better than the average of aligned sites = 38 Number in coding regions = 24 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0