AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i107_TRK_operon_mjan_reg_100.orf -o107_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ08949 251 M_jannaschii_chromosome #2 RMJ00447 140 M_jannaschii_chromosome #3 RMJ02262 46 M_jannaschii_chromosome #4 RMJ12766 32 M_jannaschii_chromosome Motif number 1 ATTTCTTATTGAACATAATGATGCTATAGACA 1 110 1 GAAATAAGAT 0.99335 -142 TTTTATAATTCAATATAAGGAATTATGATGTC 1 138 0 CAAATAAGAA 0.886532 -114 CTATGGTGATGAATATTATGAAAAAATAATCC 1 202 1 GAAATTAGAA 0.881541 -50 TCTTTGTAAAGTAGATAAAAATTGGATTAAAA 2 19 1 GTAATAAAAT 0.975452 -122 TGTCAAAATAGTATATAAAGGTTTTGATGACA 2 53 1 GTAATAAGGT 0.965905 -88 CGATGATGAAGTATTTAACAATTGTCATCAAA 2 75 0 GTATTAAAAT 0.926201 -66 TATCTTAGGATTAATTAACGATGATGAAGTAT 2 93 0 TTATTAAGAT 0.810297 -48 GAACATAAAAATCCCCCAATAA 2 129 0 GAAATAAAAT 0.979984 -12 GGTTTTATTGGAAAATAAGGATGCATTATATT 4 11 0 GAAATAAGAT 0.99335 -22 *** **** *** Masking position 6 Map Score: 10.3374 Number of sites scoring better than the average of aligned sites = 505 Number in coding regions = 451 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 2 ATTCCTGTGAAAGTCCTGTGGTATACCCAA 1 78 0 AAGTCCTGTG 0.995435 -174 ATAAGAAATTTATTCCTGTGAAAGTCCTGT 1 89 0 TATTCCTGTG 0.982107 -163 AAAACTGTGAAAGTCCTGTGCCAATAGGGC 1 166 1 AAGTCCTGTG 0.995435 -86 CAATAGGGCGAAGCCCTATGGTGATGAATA 1 187 1 AAGCCCTATG 0.980662 -65 TATGAAAAAATAATCCTATAATTAAAGTTT 1 218 1 TAATCCTATA 0.904965 -34 CATCGTTAATTAATCCTAAGATAACATTTA 2 102 1 TAATCCTAAG 0.938217 -39 ********** Masking position 7 Map Score: 7.76571 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 46 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 TGAAGTAACCAATATGGGGTTATGCCC 1 7 0 AATAGGGGTT 0.982457 -245 AATCTCTATTAAAGTGGGGTTGCCTTTGGCA 1 38 1 AAAGGGGGTT 0.993407 -214 GGTATACCCAAGAGCGGGGTTGCCAAAGGCA 1 58 0 AGAGGGGGTT 0.985483 -194 AAAAACTTTAATTATAGGATTATTTTTTCAT 1 219 0 ATTAAGGATT 0.793695 -33 TCTACTTTACAAAGAGGGATAAT 2 3 0 AAAGGGGATA 0.962836 -138 AAAGTAGATAAAAATTGGATTAAAAACTGTC 2 26 1 AAAATGGATT 0.903329 -115 GATAACATTTATTGGGGGATTTTTATGTTC 2 121 1 ATTGGGGATT 0.980899 -20 **** ****** Masking position 1 Map Score: 6.5554 Number of sites scoring better than the average of aligned sites = 223 Number in coding regions = 181 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 4 GGGCATAACCCCATATTGGT 1 1 1 GGGCATAACC 0.842022 -251 GGGTTGCCAAAGGCAACCCCACTTTAATAG 1 43 0 AGGCAACCCC 0.978049 -209 GGGTTGCCTTTGGCAACCCCGCTCTTGGGT 1 54 1 TGGCAACCCC 0.981499 -198 GAAAGTCCTGTGGTATACCCAAGAGCGGGG 1 70 0 TGGTATACCC 0.607968 -182 CATCACCATAGGGCTTCGCCCTATTGGCAC 1 183 0 GGGCTTCGCC 0.951535 -69 ********** Masking position 3 Map Score: 4.36846 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 19 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 CCACTTTAATAGAGATTTGAAGTAACCAAT 1 25 0 AGAGATTTGA 0.937911 -227 CAGGACTTTCACAGTTTTATAATTCAATAT 1 154 0 ACAGTTTTAT 0.939037 -98 TCCTATAATTAAAGTTTTTTGGTGTCAAAC 1 231 1 AAAGTTTTTT 0.945897 -21 TACTATTTTGACAGTTTTTAATCCAATTTT 2 36 0 ACAGTTTTTA 0.964511 -105 ATAGTATATAAAGGTTTTGATGACAATTGT 2 60 1 AAGGTTTTGA 0.935439 -81 AATAACCGAAAGAGTTTTGTCCATATTAAT 3 21 0 AGAGTTTTGT 0.983882 -26 ********** Masking position 6 Map Score: 4.0342 Number of sites scoring better than the average of aligned sites = 266 Number in coding regions = 236 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 6 ATTTATTCCTGTGAAAGTCCTGTGGTATAC 1 82 0 GTGAAAGTCC 0.996612 -170 TTATAAAACTGTGAAAGTCCTGTGCCAATA 1 162 1 GTGAAAGTCC 0.996612 -90 GAACATAAAAATCCCCCAATAAAT 2 127 0 ATAAAAATCC 0.935532 -14 ********** Masking position 5 Map Score: 1.55166 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 9 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 7 AGTAACCAATATGGGGTTATGCCC 1 5 0 ATGGGGTTAT 0.917172 -247 AATTCAATATAAGGAATTATGATGTCTATA 1 134 0 AAGGAATTAT 0.937646 -118 AATTCCTTATATTGAATTATAAAACTGTGA 1 146 1 ATTGAATTAT 0.949747 -106 AACTTTAATTATAGGATTATTTTTTCATAA 1 217 0 ATAGGATTAT 0.922642 -35 ACTTTACAAAGAGGGATAAT 2 1 0 GAGGGATAAT 0.909316 -140 GTAGATAAAAATTGGATTAAAAACTGTCAA 2 29 1 ATTGGATTAA 0.884026 -112 AATTAACGATGATGAAGTATTTAACAATTG 2 83 0 GATGAAGTAT 0.770698 -58 GGAAAATAAGGATGCATTATATT 4 4 0 GATGCATTAT 0.881274 -29 GGTTTTATTGGAAAATAAGGATGCAT 4 17 0 ATTGGAAAAT 0.732486 -16 ********** Masking position 9 Map Score: 3.41412 Number of sites scoring better than the average of aligned sites = 1038 Number in coding regions = 942 Number in noncoding regions = 96 Number of orfs with sites within 600 bp upstream = 86 Fraction of orfs with sites within 600 bp upstream = 0.013813 Motif number 8 TAATGATGCTATAGACATCATAATTCCTTA 1 125 1 ATAGACATCA 0.908235 -127 TTTCATAATATTCATCACCATAGGGCTTCG 1 195 0 TTCATCACCA 0.9752 -57 AGTTTGACACCAAAAAACTTTA 1 240 0 TTTGACACCA 0.964842 -12 GTATTTAACAATTGTCATCAAAACCTTTAT 2 67 0 ATTGTCATCA 0.945807 -74 TGTTAAATACTTCATCATCGTTAATTAATC 2 87 1 TTCATCATCG 0.90142 -54 GTCCATATTAATCAACTCCAGC 3 3 0 ATCAACTCCA 0.906552 -44 ********** Masking position 2 Map Score: 0.909782 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 229 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 9 TTGCCAAAGGCAACCCCACTTTAATAGAGA 1 40 0 CAACCCCACT 0.99707 -212 TTGCCTTTGGCAACCCCGCTCTTGGGTATA 1 57 1 CAACCCCGCT 0.996516 -195 CCATATTAATCAACTCCAGC 3 1 0 CAACTCCAGC 0.982755 -46 ********** Masking position 3 Map Score: 0.80911 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 5 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 10 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 12 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0