AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i175_biotin_biosynthesis1_mjan_reg_300.orf -o175_mjan_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RMJ04314 50 M_jannaschii_chromosome Input sequences: #1 RMJ13159 50 M_jannaschii_chromosome #2 RMJ01108 145 M_jannaschii_chromosome Motif number 1 TTTAAAAGTTAATGTTTATTTATTGTATAT 1 23 0 AATGTTTATT 0.986767 -28 CAATAAATTTTAAAAGTTAATGTTT 1 36 0 AATTTTAAAA 0.901761 -15 TCTCTTTTTTAGTTTTTATTAAATAAAATA 2 15 1 AGTTTTTATT 0.932856 -131 AAACCAAATAAATGCTTATTTTATTTAATA 2 31 0 AATGCTTATT 0.971028 -115 TTCCTATATCAATGATAATTGTAATTATAA 2 59 1 AATGATAATT 0.602941 -87 TGATAATCGTAATTATTATAATTACAATTA 2 74 0 AATTATTATA 0.917357 -72 CTTACCACAAAATGATAATCGTAATTATTA 2 86 0 AATGATAATC 0.881116 -60 TTTTTAATCTACTGTTTAAATAACTTACCA 2 109 0 ACTGTTTAAA 0.902049 -37 CACCTATCAAAATTTTTAATCTACTGTTTA 2 121 0 AATTTTTAAT 0.964158 -25 ********** Masking position 6 Map Score: 12.0305 Number of sites scoring better than the average of aligned sites = 917 Number in coding regions = 674 Number in noncoding regions = 243 Number of orfs with sites within 600 bp upstream = 242 Fraction of orfs with sites within 600 bp upstream = 0.0388693 Motif number 2 ATGTTTATTTATTGTATATAGGGTGATTTT 1 12 0 ATTGTATATA 0.982321 -39 ATAAATGCTTATTTTATTTAATAAAAACTA 2 24 0 ATTTTATTTA 0.97249 -122 ATCAATGATAATTGTAATTATAATAATTAC 2 66 1 ATTGTAATTA 0.992928 -80 CAAAATGATAATCGTAATTATTATAATTAC 2 79 0 ATCGTAATTA 0.98801 -67 ********** Masking position 5 Map Score: 5.14294 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 55 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 ACCCTATATACAATAAATAAACATTAACTT 1 18 1 CAATAAATAA 0.926303 -33 ATTTAATAAAAACTAAAAAAGAGAAATA 2 9 0 AACTAAAAAA 0.976454 -137 TTTTAGTTTTTATTAAATAAAATAAGCATT 2 21 1 TATTAAATAA 0.937191 -125 TGATATAGGAAACCAAATAAATGCTTATTT 2 40 0 AACCAAATAA 0.98465 -106 TTAAATAACTTACCACAAAATGATAATCGT 2 94 0 TACCACAAAA 0.952756 -52 ********** Masking position 5 Map Score: 2.53585 Number of sites scoring better than the average of aligned sites = 438 Number in coding regions = 345 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 101 Fraction of orfs with sites within 600 bp upstream = 0.0162223 Motif number 4 AAGTTAATGTTTATTTATTGTATATAGGGT 1 18 0 TTATTTATTG 0.962022 -33 ATAAATTTTAAAAGTTAATGTTTATTTATT 1 29 0 AAAGTTAATG 0.932733 -22 TTAACTTTTAAAATTTATTG 1 41 1 AAATTTATTG 0.975236 -10 AATAAATGCTTATTTTATTTAATAAAAACT 2 25 0 TATTTTATTT 0.893565 -121 CATTTTGTGGTAAGTTATTTAAACAGTAGA 2 102 1 TAAGTTATTT 0.966102 -44 TCAAAATTTTTAATCTACTGTTTAAATAAC 2 115 0 TAATCTACTG 0.944186 -31 ********** Masking position 6 Map Score: 4.78073 Number of sites scoring better than the average of aligned sites = 800 Number in coding regions = 689 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 115 Fraction of orfs with sites within 600 bp upstream = 0.0184709 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0