AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i233_protein_modification____mjan_reg_300.orf -o233_mjan_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ13697 22 M_jannaschii_chromosome #2 RMJ15370 178 M_jannaschii_chromosome Motif number 1 AACACCCCCTTTATGAAAGCGTTCAAAATTCA 2 11 0 TTATAAAGGT 0.979979 -168 TTTTAAAACATTTTGAAATACTAAGGACCAAT 2 44 0 TTTTAAATCT 0.992625 -135 TTTCAAAATGTTTTAAAAGACTCTATAAAAAG 2 58 1 TTTTAAAGCT 0.996415 -121 TTTTAGTATTATTTTAAATTCTTTTTATAGAG 2 78 0 ATTTAAATCT 0.965447 -101 GTTGTGTAATTTATTAAATTCTATTTTAATTT 2 107 0 TTATAAATCT 0.990418 -72 TGATTAAAATTATTCAAAGGCTTTACTAAAGG 2 145 1 TATTAAAGCT 0.982967 -34 TTCAAAGGCTTTACTAAAGGTTAAGTGAGAAC 2 157 1 TTACAAAGTT 0.910409 -22 **** **** ** Masking position 6 Map Score: 11.1775 Number of sites scoring better than the average of aligned sites = 273 Number in coding regions = 237 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 2 AAAAGAATTTAAAATAATACTAAAATTAAA 2 85 1 AAAATAATAC 0.976179 -94 AAATAATACTAAAATTAAAATAGAATTTAA 2 96 1 AAAATTAAAA 0.93671 -83 TAGAATTTAATAAATTACACAACATTCATT 2 116 1 TAAATTACAC 0.971825 -63 TTCATTGATTAAAATTATTCAAAGGCTTTA 2 140 1 AAAATTATTC 0.976179 -39 ********** Masking position 5 Map Score: 1.21663 Number of sites scoring better than the average of aligned sites = 157 Number in coding regions = 125 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 AAGACTCTATAAAAAGAATTTAAAATAATA 2 74 1 AAAAAGAATT 0.986749 -105 ACTAAAATTAAAATAGAATTTAATAAATTA 2 103 1 AAATAGAATT 0.970832 -76 ********** Masking position 5 Map Score: 0.30181 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0