AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i301_mixed16_mjan_reg_100.orf -o301_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ12630 135 M_jannaschii_chromosome Motif number 1 TTTAGTTTTTTGCAAAAGTTATTAAAATTC 1 26 1 TGCAAAAGTT 0.992156 -110 TGGGAAGGCGTTCAATTTTTCATTATGAAT 1 52 0 TTCAATTTTT 0.953362 -84 AAGGAAGGCGTTCATAAGTTCCTTATGTAC 1 82 1 TTCATAAGTT 0.985059 -54 CCTTATGTACTTCAAATGTTTTGCAAAAAA 1 102 1 TTCAAATGTT 0.990422 -34 AATATCACCAATAGTTTTTTGCAAAA 1 120 0 ACCAATAGTT 0.955025 -16 ********** Masking position 4 Map Score: 6.44562 Number of sites scoring better than the average of aligned sites = 378 Number in coding regions = 343 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 2 ATGAAAAATTGAACGCCTTCCCAAAGGAAG 1 59 1 GAACGCCTTC 0.516002 -77 AGGAACTTATGAACGCCTTCCTTTGGGAAG 1 75 0 GAACGCCTTC 0.516002 -61 ********** Masking position 3 Map Score: 4.48877 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 4 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 3 ACCTTAATTTAGTTTTTTGCAAAAGTTATT 1 19 1 AGTTTTTTGC 0.998377 -117 TATCACCAATAGTTTTTTGCAAAACATTTG 1 114 0 AGTTTTTTGC 0.998377 -22 ********** Masking position 5 Map Score: 3.30835 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TGAATTTTAATAACTTTTGCAAAAAACTAAA 1 26 0 TAACTTTTGA 0.973814 -110 CGTTCAATTTTTCATTATGAATTTTAATAAC 1 43 0 TTCATTATGA 0.529718 -93 TATGAACGCCTTCCTTTGGGAAGGCGTTCAA 1 67 0 TTCCTTTGGA 0.90493 -69 CGTTCATAAGTTCCTTATGTACTTCAAATGT 1 90 1 TTCCTTATGA 0.615144 -46 ********* * Masking position 6 Map Score: 4.16574 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 82 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0