AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i301_mixed16_mjan_reg_300.orf -o301_mjan_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ12630 135 M_jannaschii_chromosome Motif number 1 GAATTTTAATAACTTTTGCAAAAAACTAAA 1 26 0 AACTTTTGCA 0.992277 -110 ATTCATAATGAAAAATTGAACGCCTTCCCA 1 52 1 AAAAATTGAA 0.954076 -84 GTACATAAGGAACTTATGAACGCCTTCCTT 1 82 0 AACTTATGAA 0.985291 -54 TTTTTTGCAAAACATTTGAAGTACATAAGG 1 102 0 AACATTTGAA 0.990475 -34 TTTTGCAAAAAACTATTGGTGATATT 1 120 1 AACTATTGGT 0.955412 -16 ********** Masking position 7 Map Score: 6.44562 Number of sites scoring better than the average of aligned sites = 378 Number in coding regions = 343 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 2 CCTTCCTTTGGGAAGGCGTTCAATTTTTCA 1 60 0 GGAAGGCGTT 0.99954 -76 CCTTCCCAAAGGAAGGCGTTCATAAGTTCC 1 74 1 GGAAGGCGTT 0.99954 -62 ********** Masking position 4 Map Score: 4.48877 Number of sites scoring better than the average of aligned sites = 19 Number in coding regions = 2 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 3 ACCTTAATTTAGTTTTTTGCAAAAGTTATT 1 19 1 AGTTTTTTGC 0.998234 -117 TATCACCAATAGTTTTTTGCAAAACATTTG 1 114 0 AGTTTTTTGC 0.998234 -22 ********** Masking position 5 Map Score: 3.30835 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 GTTATTAAAATTCATAATGAAAAATTGAAC 1 43 1 TTCATAATGA 0.97349 -93 TTGAACGCCTTCCCAAAGGAAGGCGTTCAT 1 67 1 TCCCAAAGGA 0.805146 -69 ACATTTGAAGTACATAAGGAACTTATGAAC 1 91 0 TACATAAGGA 0.856164 -45 ********** Masking position 6 Map Score: 1.16665 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 86 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0