AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i332_not_clear7_mjan_reg_100.orf -o332_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ03638 44 M_jannaschii_chromosome #2 RMJ07698 216 M_jannaschii_chromosome Motif number 1 AGAATAATCCCAATTCATAAAAATAATTTTTA 1 7 1 ATCATTTAAA 0.979736 -38 GAAAATCTATTTTTAAATTTATAATAAAGACAATTT 2 21 0 TTAATTTAAA 0.984522 -196 TGAAGTGTAGTTAAAACATAATAAACAAAATAGTGG 2 68 1 TTAAATTAAC 0.871094 -149 AAATAGTGGTATATAATTTACTACTATAAAAACCTT 2 95 1 ATAATTTACA 0.979735 -122 ACCTTTGTATATTCAAATTAATAATAAGAGATAACT 2 126 1 ATAATTTAAA 0.994535 -91 TAATAATAAGAGATAACTTTTTAACCCCCTACGATA 2 144 1 AGAATTTAAC 0.96473 -73 CCCCTACGATATATAATTTCCTAAAAGCCTATCATA 2 169 1 ATAATTTAAA 0.994502 -48 AAAGCCTATCATAAAATTTTATAAGAGGGATAGGG 2 192 1 ATAATTTAAA 0.994536 -25 ** ** ** *** * Masking position 6 Map Score: 12.984 Number of sites scoring better than the average of aligned sites = 271 Number in coding regions = 181 Number in noncoding regions = 90 Number of orfs with sites within 600 bp upstream = 85 Fraction of orfs with sites within 600 bp upstream = 0.0136524 Motif number 2 ATAAAAATTATTTTTATGAATTGGGATTAT 1 14 0 TTTTTATGAA 0.949338 -31 ATAAAAATAATTTTTATGGAGGGAGATT 1 27 1 TTTTTATGGA 0.878645 -18 TAAATTGTCTTTATTATAAATTTAAAAATA 2 20 1 TTATTATAAA 0.958326 -197 AATGGAAAATCTATTTTTAAATTTATAATA 2 31 0 CTATTTTTAA 0.872955 -186 ATATAATTTACTACTATAAAAACCTTTGTA 2 105 1 CTACTATAAA 0.946235 -112 AAGTTATCTCTTATTATTAATTTGAATATA 2 133 0 TTATTATTAA 0.929086 -84 TTATGATAGGCTTTTAGGAAATTATATATC 2 176 0 CTTTTAGGAA 0.930603 -41 TCCTAAAAGCCTATCATAAAATTTTATAAG 2 187 1 CTATCATAAA 0.949995 -30 CCCTATCCCTCTTATAAAATTTTATGAT 2 199 0 CTCTTATAAA 0.966082 -18 ********** Masking position 2 Map Score: 10.7569 Number of sites scoring better than the average of aligned sites = 725 Number in coding regions = 581 Number in noncoding regions = 144 Number of orfs with sites within 600 bp upstream = 138 Fraction of orfs with sites within 600 bp upstream = 0.0221651 Motif number 3 CTTTATTATAAATTTAAAAATAGATTTTCC 2 28 1 AATTTAAAAA 0.959752 -189 GTTAAAACATAATAAACAAAATAGTGGTAT 2 77 1 AATAAACAAA 0.974144 -140 ATAATTTACTACTATAAAAACCTTTGTATA 2 107 1 ACTATAAAAA 0.972937 -110 TATTAATTTGAATATACAAAGGTTTTTATA 2 119 0 AATATACAAA 0.989579 -98 ********** Masking position 6 Map Score: 3.40175 Number of sites scoring better than the average of aligned sites = 201 Number in coding regions = 132 Number in noncoding regions = 69 Number of orfs with sites within 600 bp upstream = 85 Fraction of orfs with sites within 600 bp upstream = 0.0136524 Motif number 4 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0