AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i108_NOS_operon_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv1219c 141 hypothetical protein Rv1219c Motif number 1 GACGCAAAATCGCCCTGAACCGTGCGTTCCAG 1 22 1 CGCCTGACCG 0.999027 -120 GACGCAAAATCGCCCTGGAACGCACGGTTCAG 1 36 0 CGCCTGAACG 0.97932 -106 GTGAAGGCCGCGAACTTTGCCGAGCAGACGCA 1 62 0 CGACTTGCCG 0.994522 -80 GCAAAGTTCGCGGCCTTCACGGATTCCCAACG 1 74 1 CGCCTTACGG 0.998381 -68 CAACGGCGCCCTCCCTTGACCGGGGATGAACG 1 101 1 CTCCTTACCG 0.997782 -41 ** **** **** Masking position 6 Map Score: 13.4941 Number of sites scoring better than the average of aligned sites = 507 Number in coding regions = 482 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 2 TTCGGCGAGCAGACGCAAAATCGCCC 1 7 1 GAGCAGACGC 0.997231 -135 AATCGCCCTGGAACGCACGGTTCAGGGCGA 1 31 0 GAACGCACGG 0.978602 -111 GAACTTTGCCGAGCAGACGCAAAATCGCCC 1 53 0 GAGCAGACGC 0.997231 -89 GGGCGCCGTTGGGAATCCGTGAAGGCCGCG 1 82 0 GGGAATCCGT 0.938917 -60 CCCCGGTCAAGGGAGGGCGCCGTTGGGAAT 1 96 0 GGGAGGGCGC 0.988541 -46 GACCGGGGATGAACGTACGTTTAATATCCT 1 118 1 GAACGTACGT 0.984789 -24 ********** Masking position 8 Map Score: 8.38103 Number of sites scoring better than the average of aligned sites = 5201 Number in coding regions = 4680 Number in noncoding regions = 521 Number of orfs with sites within 600 bp upstream = 384 Fraction of orfs with sites within 600 bp upstream = 0.0616768 Motif number 3 TTCGGCGAGCAGACGCAAAATCG 1 4 1 GGCGAGCAGA 0.99728 -138 CACGGTTCAGGGCGATTTTGCGTCTGCTCG 1 16 0 GGCGATTTTG 0.993563 -126 TGCGTTCCAGGGCGATTTTGCGTCTGCTCG 1 44 1 GGCGATTTTG 0.993563 -98 CGCGAACTTTGCCGAGCAGACGCAAAATCG 1 56 0 GCCGAGCAGA 0.992561 -86 ********** Masking position 5 Map Score: 4.80137 Number of sites scoring better than the average of aligned sites = 2586 Number in coding regions = 2387 Number in noncoding regions = 199 Number of orfs with sites within 600 bp upstream = 153 Fraction of orfs with sites within 600 bp upstream = 0.0245744 Motif number 4 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0