AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i122_Arsenical_Resistance_Pump_mtub_reg_300.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv2641 101 hypothetical protein Rv2641 #2 Rv2642 135 hypothetical protein Rv2642 Motif number 1 CAAGGTATCTGGCAGGGTGGGCCT 1 4 0 GGCAGGTGGG 0.985351 -98 TGGCGCCGAACCCAGTGTGCAACATCTCTTT 1 44 0 CCCAGGTGCA 0.972815 -58 TAGGCCTGACCCCGGGGTGCGTCTCCAAGCC 2 14 1 CCCGGGTGCG 0.976393 -122 GGGTGGGCTCCGCGGCTTGGAGACGCACCCC 2 27 0 CGCGGTTGGA 0.995002 -109 CATTGAGTGGCCCGGGGTGGGCTCCGCGGCT 2 41 0 CCCGGGTGGG 0.98498 -95 AACGGCGCTACGCGGGTTAGGGGGCATTGAG 2 65 0 CGCGGTTAGG 0.995113 -71 CAAGCGGCCACGCGGTGAACGGCGCTACGCG 2 82 0 CGCGGGAACG 0.990063 -54 TTCACCGCGTGGCCGCTTGCGGACCTGATTC 2 94 1 GGCCGTTGCG 0.986559 -42 ***** ***** Masking position 5 Map Score: 21.0975 Number of sites scoring better than the average of aligned sites = 3537 Number in coding regions = 3251 Number in noncoding regions = 286 Number of orfs with sites within 600 bp upstream = 250 Fraction of orfs with sites within 600 bp upstream = 0.0401542 Motif number 2 TATATGTCAAGGTATCTGGCAGGGTGGGCCT 1 11 0 GGTATTGGCA 0.995525 -91 ACATCTCTTTGATATATGTCAAGGTATCTGG 1 23 0 GATATTGTCA 0.99552 -79 ATATATCAAAGAGATGTTGCACACTGGGTTC 1 37 1 GAGATTTGCA 0.959053 -65 GCGCCATTTTGATATAAGTCAAACAACTGGG 1 69 1 GATATAGTCA 0.982086 -33 TCAAACAACTGGGAGGTGTCTACCA 1 87 1 GGGAGTGTCT 0.945409 -15 CGCTACGCGGGTTAGGGGGCATTGAGTGGCC 2 60 0 GTTAGGGGCA 0.952535 -76 GACCTGATTCGATATTTGTCAATATTGATGT 2 115 1 GATATTGTCA 0.99552 -21 ***** ***** Masking position 4 Map Score: 10.1036 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 154 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 3 GTTGCACACTGGGTTCGGCGCCATTTTGAT 1 52 1 GGGTTCGGCG 0.994373 -50 ACGCACCCCGGGGTCAGGCCTACAG 2 6 0 GGGTCAGGCC 0.989005 -130 GGCCCGGGGTGGGCTCCGCGGCTTGGAGAC 2 34 0 GGGCTCCGCG 0.998862 -102 AGCCCACCCCGGGCCACTCAATGCCCCCTA 2 49 1 GGGCCACTCA 0.983741 -87 GCGGTGAACGGCGCTACGCGGGTTAGGGGG 2 72 0 GCGCTACGCG 0.996588 -64 GGTCCGCAAGCGGCCACGCGGTGAACGGCG 2 89 0 CGGCCACGCG 0.997302 -47 ********** Masking position 3 Map Score: 12.5204 Number of sites scoring better than the average of aligned sites = 2034 Number in coding regions = 1870 Number in noncoding regions = 164 Number of orfs with sites within 600 bp upstream = 140 Fraction of orfs with sites within 600 bp upstream = 0.0224863 Motif number 4 ********** No masking Map Score: 2.58227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.58227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.58227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0