AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i012_Glycogen_Biosynthesis_pyro_reg_100.orf -o012_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00972 82 Pyrococcus_OT3 #2 RPH01394 71 Pyrococcus_OT3 Motif number 1 AAATTTTCAGAAAGGTTAATAAGATTAAGGA 1 26 0 AAAGGTTAAA 0.995556 -57 AACCTTTCTGAAAATTTAAAAAAGTGAGGAT 1 40 1 AAAATTTAAA 0.975468 -43 TGAAACTTTGAATGGTGAAAAGG 2 3 0 AATGGTGAAA 0.968425 -69 TTCACCATTCAAAGTTTCAAATAAGGTTTTT 2 15 1 AAAGTTTCAA 0.989415 -57 TTTTAGAATTACAGTTTAATATAAAAACCTT 2 37 0 ACAGTTTAAA 0.989415 -35 ********* * Masking position 6 Map Score: 5.90373 Number of sites scoring better than the average of aligned sites = 168 Number in coding regions = 126 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 2 CCTTCATCCTTAATCTTATTAACCTTTCTG 1 20 1 TAATCTTATT 0.971001 -63 GAGTTCATCCTCACTTTTTTAAATTTTCAG 1 47 0 TCACTTTTTT 0.916591 -36 TTTAAAACCCCATTGAGAGTTCAT 1 69 0 AAACCCCATT 0.96988 -14 TTTAATATAAAAACCTTATTTGAAACTTTG 2 24 0 AAACCTTATT 0.991839 -48 GTCAGATCACCTAATTTTAGAATTAC 2 56 0 TCACCTAATT 0.986785 -16 ********** Masking position 3 Map Score: 3.37634 Number of sites scoring better than the average of aligned sites = 298 Number in coding regions = 259 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 3 TTTTTAAATTTTCAGAAAGGTTAATAAGAT 1 32 0 TTCAGAAAGG 0.982195 -51 TGAGGATGAACTCTCAATGGGGTTTTAAA 1 64 1 CTCTCAATGG 0.995837 -19 TTATTTGAAACTTTGAATGGTGAAAAGG 2 9 0 CTTTGAATGG 0.99317 -63 ********** Masking position 6 Map Score: 1.16515 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 42 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 CGGAAGCTCCCTTCATCCTTAATCTTATT 1 10 1 CCTTCATCCT 0.997292 -73 CCCCATTGAGAGTTCATCCTCACTTTTTTA 1 56 0 AGTTCATCCT 0.995398 -27 ********** Masking position 6 Map Score: 0.278564 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 16 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0