AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i025_1_2_1_2_pyro_reg_300.orf -o025_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RPH01251 23 Pyrococcus_OT3 Input sequences: #1 RPH01248 84 Pyrococcus_OT3 #2 RPH01249 28 Pyrococcus_OT3 #3 RPH01250 64 Pyrococcus_OT3 #4 RPH01252 44 Pyrococcus_OT3 #5 RPH01253 40 Pyrococcus_OT3 #6 RPH01256 31 Pyrococcus_OT3 #7 RPH01257 274 Pyrococcus_OT3 Motif number 1 ATTTACATAAATATGACCAAAAATGGGGAAC 1 4 0 AATAAATGGG 0.991229 -81 ACTTAACTTGATATAAATCGTAAGGAGGTGGCTTGAT 3 38 1 AATAAAGGGG 0.99798 -27 TTAATATTAAAAATGAAGTTTTAGGCGGTGGGGAAG 4 19 1 AATATAGGGG 0.99798 -26 TGTATAACTAATTAAACCGAAGGTGGGGAGA 6 9 1 TATAAAGGGG 0.994502 -23 TTTTGGGACAAAATTACGGGGAAGGAGTACTATGTAGA 7 59 0 AATAAAGGGT 0.991229 -216 GCTTTTGTAGTAATGATAGTTTATGGGTTTTGGGACAA 7 86 0 TATATATGGT 0.904425 -189 GACTTATAGTATATAAAGATTTAGGGGGTATTTATATG 7 213 1 AATATAGGGG 0.99798 -62 TATGAAAAAAATATCATAAATTAGGGGGTGAAAACTAT 7 247 1 AATATAGGGG 0.99798 -28 * ** * **** ** Masking position 6 Map Score: 18.491 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 40 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 CTTTCCTCTTTTTGGAGGTTTTTCC 2 14 1 TTTGGAGGTT 0.978819 -15 ATATAAATCGTAAGGAGGTGGCTTGAT 3 48 1 TAAGGAGGTG 0.991072 -17 AAATGAAGTTTTAGGCGGTGGGGAAG 4 29 1 TTAGGCGGTG 0.996226 -16 TTTGAAATTTATTGGAGGTGACTTAGATGG 7 171 0 ATTGGAGGTG 0.98347 -104 ATATAAAGATTTAGGGGGTATTTATATGAA 7 223 1 TTAGGGGGTA 0.989371 -52 ATATCATAAATTAGGGGGTGAAAACTAT 7 257 1 TTAGGGGGTG 0.997946 -18 ********** Masking position 9 Map Score: 11.674 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 39 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 TAAATATGACCAAAAATGGGGAAC 1 4 0 CAAAATGGGG 0.989643 -81 GGAAAAACCTCCAAAAAGAGGAAAGAAA 2 8 0 CAAAAAGAGG 0.931366 -21 GCTCAAAGTTGGGGGCAAAGTTTT 5 27 0 CAAGTTGGGG 0.994702 -14 CTAATTAAACCGAAGGTGGGGAGA 6 18 1 CAAGGTGGGG 0.996569 -14 GAAGAGCTTACCAAGGAGGGTAGAGC 7 6 0 CAAGGAGGGT 0.976421 -269 AGGAGTACTATGTAGATGAGGATATTTTAGC 7 44 0 TTAGATGAGG 0.870292 -231 TTGGAGGTGACTTAGATGGGTTTTAGTGGAG 7 159 0 CTAGATGGGT 0.967035 -116 AAAAATATCATAAATTAGGGGGTGAAAACTA 7 253 1 TAATTAGGGG 0.805507 -22 * ********* Masking position 4 Map Score: 8.44773 Number of sites scoring better than the average of aligned sites = 439 Number in coding regions = 406 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 4 ACTTGCGAATAATATTTTTATTTTTAACATT 1 43 1 AATATTTTAT 0.960349 -42 TTTTATTTTTAACATTTATATGCTCAATGGG 1 58 1 AACATTTAAT 0.898539 -27 TCTTTATATAAAGTTTTTCCTTGATTTA 3 8 0 AAGTTTTTCT 0.889031 -57 CCACCTCCTTACGATTTATATCAAGTTAAGT 3 38 0 ACGATTTAAT 0.879307 -27 CAAAGTTTTTAATATTAAAAATG 4 3 1 AAGTTTTTAT 0.974615 -42 GTTTTAAATAAATTATTTTAT 5 1 0 AATTATTTAT 0.807621 -40 GTTGGGGGCAAAGTTTTAAATAAATTATTTT 5 13 0 AAGTTTTAAT 0.974611 -28 CTATAAGTCGAATATTTACATTTTGAAATTT 7 191 0 AATATTTAAT 0.960325 -84 ATACCCCCTAAATCTTTATATACTATAAGTC 7 213 0 AATCTTTAAT 0.916043 -62 AATTTATGATATTTTTTTCATATAAATACCC 7 238 0 ATTTTTTTAT 0.82417 -37 ******** ** Masking position 6 Map Score: 9.04748 Number of sites scoring better than the average of aligned sites = 202 Number in coding regions = 134 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 93 Fraction of orfs with sites within 600 bp upstream = 0.0149374 Motif number 5 AAAAATAAAAATATTATTCGCAAGTAATTT 1 38 0 ATATTATTCG 0.621415 -47 TAAAAATGAAGTTTTAGGCGGTGGGGAAG 4 26 1 GTTTTAGGCG 0.944302 -19 GCTCAAAGTTGGGGGCAAAGTTTTA 5 26 0 AAGTTGGGGG 0.902424 -15 TTTTGGGACAAAATTACGGGGAAGGAGTAC 7 67 0 AAATTACGGG 0.939294 -208 TAGTAATGATAGTTTATGGGTTTTGGGACA 7 87 0 AGTTTATGGG 0.939294 -188 ACTTAGATGGGTTTTAGTGGAGCAGCTTGG 7 151 0 GTTTTAGTGG 0.948032 -124 TACATTTTGAAATTTATTGGAGGTGACTTA 7 176 0 AATTTATTGG 0.932745 -99 AGTATATAAAGATTTAGGGGGTATTTATAT 7 220 1 GATTTAGGGG 0.988925 -55 AAAATATCATAAATTAGGGGGTGAAAACTA 7 254 1 AAATTAGGGG 0.985398 -21 ********** Masking position 5 Map Score: 7.86871 Number of sites scoring better than the average of aligned sites = 394 Number in coding regions = 340 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 59 Fraction of orfs with sites within 600 bp upstream = 0.00947639 Motif number 6 ATTCGCAAGTAATTTACATAAATATGACCA 1 23 0 AATTTACATA 0.923028 -62 TTATTTTTAACATTTATATGCTCAATGGGA 1 60 1 CATTTATATG 0.860431 -25 TAAAGTTTTTCCTTGATTTA 3 1 0 CCTTGATTTA 0.894422 -64 TCAAGGAAAAACTTTATATAAAGACTTAAC 3 15 1 ACTTTATATA 0.971277 -50 TAAAGACTTAACTTGATATAAATCGTAAGG 3 33 1 ACTTGATATA 0.950404 -32 ATAAAATAATTTATTTAAAACTTTGCC 5 8 1 AATTTATTTA 0.886481 -33 AAAATATCCTCATCTACATAGTACTCCTTC 7 47 1 CATCTACATA 0.792046 -228 ACCCCCTAAATCTTTATATACTATAAGTCG 7 212 0 TCTTTATATA 0.910934 -63 ********** Masking position 6 Map Score: 4.64246 Number of sites scoring better than the average of aligned sites = 144 Number in coding regions = 110 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 7 CTGCTAGTTCCAACGATTCTTGCTTTTGTA 7 115 0 CAACGATTCT 0.953176 -160 GCAGCTTGGGCCACGCTGCTAGTTCCAACG 7 130 0 CCACGCTGCT 0.997572 -145 GCAGCGTGGCCCAAGCTGCTCCACTAAAAC 7 141 1 CCAAGCTGCT 0.993293 -134 ********** Masking position 3 Map Score: 0.314648 Number of sites scoring better than the average of aligned sites = 26 Number in coding regions = 22 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 8 ********** No masking Map Score: 1.67931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.67931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.67931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0