AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i034_Pyruvate_Synthase_2_pyro_reg_300.orf -o034_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00434 225 Pyrococcus_OT3 #2 RPH00433 33 Pyrococcus_OT3 #3 RPH00430 30 Pyrococcus_OT3 Motif number 1 AGAAAAGAAAAGGTGATGAAGA 1 3 0 AGGTGATGAA 0.991741 -223 AAAGGCTAATAGGTGAAGAAAAGAAAAGGT 1 19 0 AGGTGAAGAA 0.984372 -207 AAAAGACTTTCGGTAATAGTACAATCTAAA 1 60 1 CGGTAATAGT 0.925828 -166 TACATATATTCGGCGATCAACGATTTTAGA 1 84 0 CGGCGATCAA 0.942033 -142 GAATATATGTAGGTAATGATAGCATTTGAC 1 103 1 AGGTAATGAT 0.969751 -123 ATGTAGTTTTCGGTGGAGGTACTAAGACAT 1 143 0 CGGTGGAGGT 0.884917 -83 AAGCTTAAGGGGGCAAAAAAG 1 215 1 GGGCAAAAAA 0.835478 -11 CTCTCAAAAAGGGTAATAAAT 3 2 0 GGGTAATAAA 0.951935 -29 CCTTTTTGAGAGGTGATGGAT 3 20 1 AGGTGATGGA 0.990004 -11 ********** Masking position 3 Map Score: 10.7774 Number of sites scoring better than the average of aligned sites = 658 Number in coding regions = 587 Number in noncoding regions = 71 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 2 TTAGCCTTTCAACCCTTTATAAAAGACTTTC 1 40 1 AACCCTTATA 0.990141 -186 AATGCTATCATTACCTACATATATTCGGCGA 1 98 0 TTACCTCATA 0.950015 -128 ACCTCCACCGAAAACTACATAAATCTAACTT 1 153 1 AAAACTCATA 0.964782 -73 ATCTAACTTAAAAACTCTAGATTGAACTCAG 1 175 1 AAAACTTAGA 0.874696 -51 TTTTCTTAAACCTTTTTATATGGAGGGA 2 8 1 AAACCTTTTA 0.973086 -26 AGGTATCCCTCCATATAAAAAGGTT 2 19 0 ATCCCTCATA 0.981398 -15 ATTTATTACCCTTTTTGAGAGGTGATG 3 7 1 TACCCTTTTG 0.853969 -24 ****** **** Masking position 6 Map Score: 4.35028 Number of sites scoring better than the average of aligned sites = 446 Number in coding regions = 404 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 3 TCAACGATTTTAGATTGTACTATTACCGAA 1 68 0 TAGATTGTAC 0.993622 -158 TTAAAAACTCTAGATTGAACTCAGATTAAT 1 182 1 TAGATTGAAC 0.993622 -44 ********** Masking position 5 Map Score: 0.339012 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0