AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i038_Galactose_Metabolism__pyro_reg_300.orf -o038_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00721 54 Pyrococcus_OT3 #2 RPH00717 92 Pyrococcus_OT3 Motif number 1 TTTGACTATTATAGTCAAAAC 2 2 0 ATAGTCAAAA 0.997623 -91 TTTGACTATAATAGTCAAAAACTTAATAAA 2 13 1 ATAGTCAAAA 0.997623 -80 GCTCACTCACATTGTCGAAAATTTTATTAA 2 35 0 ATTGTCGAAA 0.992876 -58 GTAATGTTGTAGAGTCTAAAAATCTTCAAG 2 64 0 AGAGTCTAAA 0.992892 -29 ********** Masking position 5 Map Score: 9.17926 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 18 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 CACCAACCTTAAAATTGTTTAGTTCAAAGTAT 1 28 0 AATTGTTTAG 0.991952 -27 AAACAATTTTAAGGTTGGTGAGAGT 1 40 1 AATTGGTGAG 0.998112 -15 CATTGTCGAAAATTTTATTAAGTTTTTGACTA 2 24 0 AATTATTAAG 0.982048 -69 AATTTTCGACAATGTGAGTGAGCTTGAAGATT 2 42 1 AATGAGTGAG 0.990628 -51 AAAGATCAGTAATGTTGTAGAGTCTAAAAATC 2 70 0 AATTGTAGAG 0.993327 -23 ** ******** Masking position 5 Map Score: 6.12752 Number of sites scoring better than the average of aligned sites = 184 Number in coding regions = 177 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0