AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i047_Polysaccharide_Biosynthesis_1_pyro_reg_300.orf -o047_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00713 51 Pyrococcus_OT3 #2 RPH00710 47 Pyrococcus_OT3 Motif number 1 TTCAGCTTAGCCCTTGTCTCTTCA 1 5 0 CCCTTGTCTC 0.998912 -47 CTGTTTCGAACTCTTCTTTCAGCTTAGCCC 1 22 0 CTCTTCTTTC 0.995427 -30 AGGCTCACCCCTGTTTCGAACTCTTCT 1 35 0 CCCCTGTTTC 0.998912 -17 ********** Masking position 5 Map Score: 5.3196 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 8 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 TGAAGAGACAAGGGCTAAGCTG 1 3 1 AAGAGACAAG 0.975405 -49 GACAAGGGCTAAGCTGAAAGAAGAGTTCGA 1 17 1 AAGCTGAAAG 0.985903 -35 CAATGGATAAAAACTCCATGCTATTTATAT 2 15 1 AAACTCCATG 0.986697 -33 TTAACCACCAAGCATATAAATA 2 36 0 AACCACCAAG 0.993694 -12 ********** Masking position 8 Map Score: 1.2765 Number of sites scoring better than the average of aligned sites = 373 Number in coding regions = 341 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 3 GAAGAGACAAGGGCTAAGCTGAAAGAAGAG 1 12 1 GGGCTAAGCT 0.986582 -40 GTTCGAAACAGGGGTGAGCCT 1 41 1 GGGGTGAGCC 0.981341 -11 ********** Masking position 5 Map Score: 0.762967 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 9 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0