AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i048_Polysaccharide_Biosynthesis_2_pyro_reg_300.orf -o048_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01490 246 Pyrococcus_OT3 Motif number 1 AATTTATCAAGTTATAAGGATTCTCACTTGG 1 35 1 GTTAAAGGAT 0.985781 -212 TTTCAGATGCATTTTATGGCTATCTCCTTTT 1 102 1 ATTTATGGCT 0.973783 -145 TTACCCTGAAATTAAAAGGAGATAGCCATAA 1 115 0 ATTAAAGGAG 0.985782 -132 TAGCAAGCATATTACAAGGATTAAGCTGAAA 1 155 1 ATTAAAGGAT 0.994752 -92 AAAATCTTCCAGTTTATGGATAGGACAAGAA 1 183 1 AGTTATGGAT 0.973783 -64 CTAACGCTTAATTTTAAGGATTTCTTGTCCT 1 204 0 ATTTAAGGAT 0.994714 -43 **** ****** Masking position 6 Map Score: 9.82929 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 31 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 ACTTGATAAATTACAGTTTAATTGTGGTAGA 1 16 0 TTACAGTTAA 0.934753 -231 TTTCTCATCCTTTCAGATGCATTTTATGGCT 1 92 1 TTTCAGTGCA 0.981792 -155 CTCCTTTTAATTTCAGGGTAAATAAGGAATT 1 125 1 TTTCAGGTAA 0.984598 -122 ACTGGAAGATTTTCAGCTTAATCCTTGTAAT 1 165 0 TTTCAGTTAA 0.99599 -82 GCTGAAAATCTTCCAGTTTATGGATAGGACA 1 179 1 TTCCAGTTAT 0.977721 -68 ****** **** Masking position 5 Map Score: 5.89004 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 36 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 GTTATCTACCACAATTAAACTGTAATTTAT 1 12 1 ACAATTAAAC 0.955647 -235 AGAAATTTATATAAATTAACAAAGAAAGCG 1 67 0 ATAAATTAAC 0.806773 -180 AGGGTAAATAAGGAATTAGCAAGCATATTA 1 139 1 AGGAATTAGC 0.965706 -108 GCATATTACAAGGATTAAGCTGAAAATCTT 1 161 1 AGGATTAAGC 0.989903 -86 AGAAATCCTTAAAATTAAGCGTTAGTCTAA 1 210 1 AAAATTAAGC 0.975792 -37 CCCACCTGGCAAGATTAGACTAACGCTTAA 1 224 0 AAGATTAGAC 0.936463 -23 ********** Masking position 6 Map Score: 3.53371 Number of sites scoring better than the average of aligned sites = 184 Number in coding regions = 160 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 4 GTTTAATTGTGGTAGATAACA 1 2 0 GGTAGATAAC 0.985722 -245 CTTATAACTTGATAAATTACAGTTTAATTG 1 23 0 GATAAATTAC 0.954758 -224 TTAATTTCAGGGTAAATAAGGAATTAGCAA 1 131 1 GGTAAATAAG 0.983289 -116 CTCCCACCTGGCAAGATTAGACTAACGCTT 1 226 0 GCAAGATTAG 0.951781 -21 ********** Masking position 6 Map Score: 0.440054 Number of sites scoring better than the average of aligned sites = 115 Number in coding regions = 100 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 5 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0