AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i058_Cystheine_Biosynthesis_pyro_reg_300.orf -o058_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00066 300 Pyrococcus_OT3 Motif number 1 TTTAGTAATTGAAAGTTATTAAATAACGAATTG 1 35 0 GAAATTATAA 0.951726 -266 ATTCCCTCAGAAAAGTTATGGCATATTTAGTAA 1 60 0 AAAATTATCA 0.97599 -241 TTTCTGAGGGAATATTTTTGGAATTCATCCGAA 1 80 1 AATATTTTAA 0.950939 -221 AAAAATTTTCAATATATATGCAAATCAGAATAT 1 133 0 AATAATATAA 0.931162 -168 ATATATATTGAAAATTTTTAGAAATCACACCTA 1 147 1 AAAATTTTAA 0.977172 -154 TTACAAAGTTAAAATGTAAACAATAATTTAGGT 1 175 0 AAAAGTAAAA 0.874684 -126 TTATCAAAGTAAAATTTTACAAAGTTAAAATGT 1 191 0 AAAATTTAAA 0.922476 -110 TATCAGGAATAAAACTTATCAAAGTAAAATTTT 1 206 0 AAAATTATAA 0.989533 -95 AATTCTAGATAATAATTATATCTATCAGGAATA 1 228 0 AATATTATCT 0.836484 -73 ATTATGTCGAAAAAGATATAAATAGATTCGAGA 1 258 1 AAAAATATAT 0.892522 -43 **** **** ** Masking position 7 Map Score: 10.9628 Number of sites scoring better than the average of aligned sites = 482 Number in coding regions = 336 Number in noncoding regions = 146 Number of orfs with sites within 600 bp upstream = 151 Fraction of orfs with sites within 600 bp upstream = 0.0242531 Motif number 2 CTATTTTGGCTTCTGTTTTCGGATGAATTC 1 100 0 TTCTGTTTTC 0.952085 -201 TCAGAATATATGCTATTTTGGCTTCTGTTT 1 112 0 TGCTATTTTG 0.966883 -189 ATAGCATATATTCTGATTTGCATATATATT 1 126 1 TTCTGATTTG 0.975416 -175 TTGTTTACATTTTAACTTTGTAAAATTTTA 1 185 1 TTTAACTTTG 0.931147 -116 CTTTGTAAAATTTTACTTTGATAAGTTTTA 1 200 1 TTTTACTTTG 0.978019 -101 ********** Masking position 7 Map Score: 1.36271 Number of sites scoring better than the average of aligned sites = 154 Number in coding regions = 140 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 ATAAAGATAGATATGTTCCAATTCGTTATT 1 17 1 ATATGTTCCA 0.970805 -284 TTCAATTACTAAATATGCCATAACTTTTCT 1 55 1 AAATATGCCA 0.982691 -246 TGAATTCCAAAAATATTCCCTCAGAAAAGT 1 77 0 AAATATTCCC 0.935341 -224 CTGTTTTCGGATGAATTCCAAAAATATTCC 1 88 0 ATGAATTCCA 0.891177 -213 GCAAATCAGAATATATGCTATTTTGGCTTC 1 117 0 ATATATGCTA 0.961549 -184 AATTTTCAATATATATGCAAATCAGAATAT 1 133 0 ATATATGCAA 0.961548 -168 AAAGATATAAATAGATTCGAGAACCTTTGA 1 269 1 ATAGATTCGA 0.918185 -32 ********** Masking position 1 Map Score: 5.30759 Number of sites scoring better than the average of aligned sites = 265 Number in coding regions = 239 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0